We narrowed to 4,220 results for: PRS
-
Plasmid#207444Purpose6xHis-SS-TEV-ErkB-Y178A bacterial expression vectorDepositorInsertErkB
UseUnspecifiedMutationY178AAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAF9D94 (pAF10C6)
Plasmid#185848PurposeExpressing artificial trans-repressor in Saccharomyces cerevisiaeDepositorInsertPHAC1>TetR>CYC8>PABF1
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB441
Plasmid#185131PurposeSwi6 full length with L->A mutated in nuclear localization signalDepositorInsertSWI6
TagsGFPExpressionYeastMutationSWI6 deletion of amino acids 450-458Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB556
Plasmid#185108Purpose1st 200 amino acids (N-term + transmembrane domain) of Pom152 fused to HA and GFP with S158A, F159A, F160ADepositorInsertPOM152
TagsGFPExpressionYeastMutation1st 200 amino acids (N-term + transmembrane domai…Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB553
Plasmid#185107Purpose1st 200 amino acids (N-term + transmembrane domain) of Pom152 fused to HA and GFP with Y180L, Q182LDepositorInsertPOM152
TagsGFPExpressionYeastMutation1st 200 amino acids (N-term + transmembrane domai…Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB439
Plasmid#185093PurposeNMA111-GFP wild type under control of GAL1 promoter (complements nma111 deletion)DepositorInsertNMA111
TagsGFPExpressionYeastMutationGAL1::NMA111-GFPPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB345
Plasmid#185078Purposerfa3D46 truncation fused to GFPDepositorInsertRFA3
TagsGFPExpressionYeastMutationRfa3 truncation aa 1-46Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB419
Plasmid#185089PurposeSwi6L-GFP expressing N-term 273 amino acids of Swi6DepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 truncation at aa 273Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB462
Plasmid#185095PurposeNMA111-GFP with NLS1 and NLS2 mutated under control of GAL1 promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationGAL1::nma111Dnls1Dnls2-GFPPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB354
Plasmid#185082PurposeSwi6L-GFP expressin N-term 273 amino acids of Swi6DepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 truncation aa 1-273Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB416
Plasmid#185087PurposeSwi6L-GFP with nuclear export signal mutated to alaninesDepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 nuclear export signal L to A mutationsAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB394
Plasmid#185086PurposeNMA111 with both nuclear localization signals mutated to alanines fused to GFP (mutagenesis of KBB280)DepositorInsertNMA111
TagsGFPExpressionYeastMutationNma111 KKR 9-11 AAA; KRK 28-30 AAAAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB349
Plasmid#185080Purposerfa2D248 truncation fused to GFPDepositorInsertRFA2
TagsGFPExpressionYeastMutationRfa2 truncation aa 1-247Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB353
Plasmid#185081PurposeSwi6M-GFP expressing N-term 181 amino acids of Swi6DepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 truncation aa 1-181Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB484
Plasmid#185132PurposeSWI6-GFP full length under control of GAL1 promotionDepositorInsertSWI6
TagsGFPExpressionYeastAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-197
Plasmid#169924PurposeWT Ecm2 mutated to introduce stop codon after AA 197 of Ecm2DepositorInsertEcm2 1-197
ExpressionBacterial and YeastAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBHRSF228
Plasmid#135007PurposeMusF2 prenyltransferases from Nostoc sp. UHCC 0398DepositorInsertMusF2 prenyltransferase
ExpressionBacterialAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165V
Plasmid#158965PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165V
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165R
Plasmid#158966PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165R
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only