We narrowed to 105 results for: Folding Reporter GFP
-
Plasmid#217372PurposesfGFP reporter for chimeric riboswitch with Cbe pfl ZTP riboswitch aptamer and WT Pca rhtB ZTP riboswitch expression platformDepositorInsertChimeric ZTP riboswitch with Cbe pfl aptamer and WT Pca rhtB expression platform sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJBL7316
Plasmid#217371PurposesfGFP reporter for chimeric riboswitch with Cbe pfl ZTP riboswitch aptamer and transcriptional variant of Pca rhtB ZTP riboswitch expression platformDepositorInsertChimeric ZTP riboswitch with Cbe pfl aptamer and transcriptional variant of Pca rhtB expression platform sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
HC-M
Plasmid#173481PurposeAn rrnB P1-based GFP ATP reporter in E. coliDepositorInsertGFP-mut2
UseSynthetic BiologyTagsssrA degradation tagExpressionBacterialPromoterrrnB P1Available SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
env8 reverse J1/13
Plasmid#99831PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 reverse J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 sequence is reversedAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 16nt J1/13
Plasmid#99832PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 16nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 16 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 19nt J1/13
Plasmid#99834PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 19nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 19 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 17nt J1/13
Plasmid#99833PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 17nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 17 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 24nt J1/13
Plasmid#99835PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 24nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 24 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 7U J1/13
Plasmid#99829PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 7U J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 converted to 7 U'sAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 25nt J1/13
Plasmid#99836PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 25nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 25 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 AC rep J1/13
Plasmid#99830PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 AC rep J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 converted to repeating AC'sAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGustiv
Plasmid#240335PurposeExpresses BK polyomavirus genotype IV capsid protein VP1 in yeast. Expression of VP1 (and a GFP reporter) is induced by maltose.DepositorInsertsBKV-IV VP1
Superfold GFP
Formaldehyde dehydrogenase 1
ExpressionYeastPromoterFDH1, MAL31, and MAL32Available SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOGG037
Plasmid#113995PurposeSC module. Super-folder GFP green fluorescence reporterDepositorInsertSuper-folder GFP
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S2-cAMPr
Plasmid#160723PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter cAMPr (cAMP indicator), HA tag, and S2 protein scaffold.DepositorInsertS2-cAMPr
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S3-ExRaiAKAR
Plasmid#160724PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter ExRai-AKAR (PKA indicator), V5 tag, and S3 protein scaffold.DepositorInsertS3-ExRaiAKAR
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S1-GCaMP6f
Plasmid#160722PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter GCaMP6f (calcium indicator), Xpress tag, and S1 protein scaffold.DepositorInsertS1-GCaMP6f
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S4-ExRaiCKAR
Plasmid#160725PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter ExRai-CKAR (PKC indicator), OLLAS tag, and S4 protein scaffold.DepositorInsertS4-ExRaiCKAR
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s
Plasmid#100020PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting superfolder cpGFP.DepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s-T78H
Plasmid#100021PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference LSSmOrange nested within the reporting superfolder cpGFP-T78HDepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM007
Plasmid#170011PurposeEncodes PslyB-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PslyBAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAM005
Plasmid#170009PurposeEncodes PvirK-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PvirKAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM002
Plasmid#170006PurposeEncodes PpmrD-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PpmrDAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM003
Plasmid#170007PurposeEncodes PmgtC-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PmgtCAvailabilityAcademic Institutions and Nonprofits only -
pAM004
Plasmid#170008PurposeEncodes PugtL-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PugtLAvailabilityAcademic Institutions and Nonprofits only -
pAM006
Plasmid#170010PurposeEncodes PpagC-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PpagCAvailabilityAcademic Institutions and Nonprofits only -
pSliceRep_A_miR-196a.M3
Plasmid#220467PurposeDual luciferase reporter for RNAi, with target site within a tunable ORF (version A)DepositorInsertSuperfolder GFP
Tags3xFLAGExpressionMammalianPromoterMinimal CMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSliceRep_A_miR-7
Plasmid#220464PurposeDual luciferase reporter for RNAi, with target site within a tunable ORF (version A)DepositorInsertSuperfolder GFP
Tags3xFLAGExpressionMammalianPromoterMinimal CMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSliceRep_A_miR-7.M4
Plasmid#220465PurposeDual luciferase reporter for RNAi, with target site within a tunable ORF (version A)DepositorInsertSuperfolder GFP
Tags3xFLAGExpressionMammalianPromoterMinimal CMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSliceRep_A_miR-196a
Plasmid#220466PurposeDual luciferase reporter for RNAi, with target site within a tunable ORF (version A)DepositorInsertSuperfolder GFP
Tags3xFLAGExpressionMammalianPromoterMinimal CMVAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDRF'- AmTryoshka1;3-LS-F138I
Plasmid#100922PurposeYeast expression of fluorescent sensor reporting the activity of ammonium transceptors. Contains a stable reference LSSmOrange nested within the reporting superfolder cpEGFP.DepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDRF'- AmTryoshka1;3-LS-L255I
Plasmid#100964PurposeYeast expression of fluorescent sensor reporting the activity of ammonium transceptors. Contains a stable reference LSSmOrange nested within the reporting superfolder cpEGFP.DepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDRF'- AmTryoshka1;3-GS-F138I
Plasmid#100965PurposeYeast expression of fluorescent sensor reporting the activity of ammonium transceptors. Contains a stable reference LSSmOrange nested within the reporting superfolder cpEGFP.DepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDRF'- AmTryoshka1;3-GS-L255I
Plasmid#100966PurposeYeast expression of fluorescent sensor reporting the activity of ammonium transceptors. Contains a stable reference LSSmOrange nested within the reporting superfolder cpEGFP.DepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDRF'- AmTryoshka1;3-LS-F138I-T78H
Plasmid#100963PurposeYeast expression of fluorescent sensor reporting the activity of ammonium transceptors. Contains a stable reference LSSmOrange nested within the reporting superfolder cpEGFPDepositorInsertAmTryoshka1;3-LS-F138I-T78H (AMT1;3 Mustard Weed)
ExpressionYeastMutationF138I, T78HPromoterPMAAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfGCaMP6s
Plasmid#100022PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. cpEGFP replaced with a superfolder cpGFP variant.DepositorInsertsfGCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfGCaMP6s-T78H
Plasmid#100023PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. cpEGFP replaced with a superfolder cpGFP variant containing T78H mutationDepositorInsertsfGCaMP6s-T78H
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTSAR3.1t
Plasmid#210254PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneriDepositorInsertsmCerulean
superfolder GFP
TagsssraExpressionBacterialPromoteripaH7.8p and rpsMAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTSAR3.5t
Plasmid#210257PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneriDepositorInsertseBFP2
superfolder GFP
TagsssraExpressionBacterialPromoteripaH7.8p and rpsMAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTSAR3.6t
Plasmid#210258PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneriDepositorInsertsmScarlet
superfolder GFP
TagsssraExpressionBacterialPromoteripaH7.8p and rpsMAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTSAR3.4t
Plasmid#210256PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneriDepositorInsertsmCherry
superfolder GFP
TagsssraExpressionBacterialPromoteripaH7.8p and rpsMAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTSAR3.7t
Plasmid#210259PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneriDepositorInsertse2Crimson
superfolder GFP
TagsssraExpressionBacterialPromoteripaH7.8p and rpsMAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTSAR3.3t
Plasmid#210255PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneriDepositorInsertsDsRed
superfolder GFP
TagsssraExpressionBacterialPromoteripaH7.8p and rpsMAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE2
Plasmid#90336PurposeATF6 - Unfolded protein response element (UPRE) gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterATF6Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
sspa-GCaMP6s
Plasmid#67559Purposeshort photoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6s
ExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
spa-GCaMP6s
Plasmid#67556Purposephotoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6s
TagsHIS-tagExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
sspa-GCaMP6f
Plasmid#67561Purposeshort photoactivatable fluorescent calcium reporterDepositorInsertsspa-GCaMP6f
ExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
spa-GCaMP6f
Plasmid#67558Purposephotoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6f
TagsHIS-tagExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…PromoterCMVAvailable SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only