We narrowed to 11,988 results for: 110
-
Plasmid#110403PurposeCRISPR/Cas9 vector with sgRNA expression and puromycin resistanceDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBhAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pMEXNH3
Plasmid#110079PurposeAnalogous to pMINTNH3, but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTagsHis10 Tag - 3C cleavage siteExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ultra-Exon1Q145-Myc-A
Plasmid#110487PurposeLentiviral vector to express mutant N terminal HTT gene with short 3'UTR in mammalian cells (encodes Myc-tagged mutant huntingtin exon1 fragment with 145 repeats of Q)DepositorInsertHomo sapiens huntingtin (HTT Human)
UseLentiviralTagsMycExpressionMammalianMutationPartial long 3'UTR wild type huntingtin exon…PromoterUbCAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pediculus humanus corporis PINK1 (143 - 575)
Plasmid#110751PurposeBacterial expression of PhPINK1 (crystallography)DepositorInsertPhum_PHUM577390 (Phum_PHUM577390 Pediculus humanus corporis)
TagsN-His6-SUMOExpressionBacterialPromoterT7Available SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ultra-Exon1Q23-Myc-A
Plasmid#110486PurposeLentiviral vector to express wild-type N terminal HTT gene with short 3'UTR in mammalian cells (encodes Myc-tagged wild type huntingtin exon1 fragment with 23 repeats of Q)DepositorInsertHomo sapiens huntingtin (HTT Human)
UseLentiviralTagsMycExpressionMammalianMutationShort 3'UTR wild type huntingtin exon1 fragm…PromoterUbCAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRepCap6
Plasmid#110770PurposepRepCap6 contains both rep and cap genes from the AAV6 genome, but lacks the viral terminal repeats (Rutledge et al., 1998). It lacks adenovirus helper functions required for stock production.DepositorInsertAAV6 cap, AAV6 rep genes
UseAAVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1_MeCP2(WT)
Plasmid#110186PurposeExpression of mouse MeCP2 (WT) in mammalian cellsDepositorInsertMeCP2_e2 FL (mouse cDNA) (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationwild typePromoterCMVAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-BHLHE40
Plasmid#110154PurposeExpression of human BHLHE40 in mammalian cellsDepositorInsertBHLHE40 (basic helix-loop-helix family member e40) (BHLHE40 Human)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSET-6xTR-TUBE
Plasmid#110313PurposeE. coli expression and purification of 6xTR-TUBEDepositorInsert6xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p181 pK7-HDAC1 (GFP)
Plasmid#11054DepositorAvailable SinceApril 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
ExpressionBacterialPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 N549K 3xFlag
Plasmid#110107Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Asparagine 549 to Lysine (N549K)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM253 (miniCTX1-rhaSR-PrhaBAD)
Plasmid#110571PurposeIntegration vector for Pseudomonas aeruginosa with rhaSR-PrhaBAD inducible promoterDepositorInsertrhaSR-PrhaBAD
ExpressionBacterialPromoterrhaSR-PrhaBADAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB-CAGGS-dCas9-KRAB
Plasmid#110822PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorInsertdCas9-KRAB
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCAGGSAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3-HA-SOX4
Plasmid#110367PurposeMammalian expression of HA-tagged SOX4DepositorAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFR L858R
Plasmid#11012PurposeRetroviral construct for expressing human EGFR with L858R mutation in human cellsDepositorAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
ELONGIN BC (XX01TCEB1A-c001)
Plasmid#110274PurposeElongin B and Elongin C co-expression plasmid for structure determination; Full length Elongin B & amino acids 17-112 of Elogin CDepositorExpressionBacterialMutationElongin B is full length. Elongin C contains a.a…PromoterT7Available SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only