We narrowed to 370 results for: gag pol
-
Plasmid#228959PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-B2M-miniGag-Cas9
Plasmid#228958PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 POLD1
Plasmid#67128PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgPOLR2D
Plasmid#125769Purposeconstitutive expression of a guide RNA targeting human POLR2D (CRISPR positive control)DepositorInsertsgPOLR2D (POLR2D Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P POLA1_1
Plasmid#160789PurposeSuppress POLA1DepositorInsertshPOLA1_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-POLB-KO-g1
Plasmid#176090PurposeCas9 plus POLB gRNA #1; contains a puromycin resistance cassetteDepositorAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole4 KO sgRNA
Plasmid#186935PurposePole4 KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#1/Cre
Plasmid#173609PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-PolB1-puro
Plasmid#177146PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
dRT-pMDLg/pRRE
Plasmid#60488Purposegag/pol packaging plasmid for production of lentiviral vectors with mutated reverse transcriptase (NRTLV, non-reverse transcribable lentiviral vectors)DepositorInsertHIV-1 gag, HIV-1 pol with inactive reverse transcriptase
Mutationchanged Asp at position 249 + 250 to ValAvailable SinceOct. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMDlg/pRRE-int-MS2M
Plasmid#166032PurposeExpression of bacteriophage-derived MS2 coat protein fused HIV-1 Lentiviral Gag-Pol at C terminal with a HIV-1 protease cleavage signal between MS2 and Gag-Pol.DepositorInsertGag-Pol-MS2
UseLentiviralMutationD64V mutation within the integrase within PolAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMDLg/pRRE
Plasmid#12251Purpose3rd generation lentiviral packaging plasmid; Contains Gag and Pol; also requires pRSV-Rev (Addgene#12253) and envelope expressing plasmid (Addgene#12259)DepositorInsertHIV-1 GAG/POL
UseLentiviral; PackagingExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
p8.9 NdeltaSB
Plasmid#132929PurposeMinimal HIV-1 packaging plasmid for gag and pol expressionDepositorInsertgag and pol
UseLentiviralAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIG3 N
Plasmid#132941PurposeMLV packaging plasmid for N-tropic MLV gag-pol expressionDepositorInsertN-tropic MLV gag-pol
UseRetroviralAvailable SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIG3 B
Plasmid#132942PurposeMLV packaging plasmid for B-tropic MLV gag-pol expressionDepositorInsertB-tropic MLV gag-pol
UseRetroviralAvailable SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only