-
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
FASTKD3 gRNA (BRDN0001147359)
Plasmid#78065Purpose3rd generation lentiviral gRNA plasmid targeting human FASTKD3DepositorInsertFASTKD3 (FASTKD3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12C/sgKras/Cre
Plasmid#99850PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12V/sgKras/Cre
Plasmid#99854PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE3 mutant
Plasmid#133310PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 3DepositorInserteIF3B promoter MBE3 mutant (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationccacgtgacc changed to cAaAAAAaccPromotereIF3BAvailable sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode8
Plasmid#229070PurposeExpression mappingDepositorInsertCAG Barcode8
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
LHZ1494
Plasmid#222104PurposeTriple sgRNAs expression plasmid in Kluyveromyces marxianus.DepositorInsertsg1RNA, sg4RNA, sg7RNA
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode19
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS15_MATz
Plasmid#166100PurposeExpression of dual gRNA targeting the MAT locusDepositorInsertMAT Z1
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfb13221
Plasmid#219896PurposeThe base plasmid of TUNEYALI for TF31DepositorInsertContains gRNA targeting TF31 (YALI1_D18727g) and homologous arm matching TF31
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorInsertYFR054C gRNA (YFR054C Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorInsertTLG1 gRNA (TLG1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorInsertADE13 gRNA (ADE13 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEX-A-U6-MaSgRNA_PuroR
Plasmid#84780PurposeExpresses major satellite-specific sgRNA.DepositorInsertmajor satellite-specific sgRNA
UseCRISPRTagsExpressionBacterial and MammalianMutationPromoterU6Available sinceJuly 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hBRAF-2
Plasmid#185366PurposeFor mammalian expression of guide RNA: caccgAAAATCCCACAGATGTGGCA that targets human BRAFDepositorInsertBRAF (BRAF Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU1-CDS
Plasmid#136048PurposeSTAU1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGAGTAAAGCCTAGAATCAAA)DepositorInsertSTAU1 (STAU1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSC101-GFPmut2-mScarlet-I A6T
Plasmid#208194Purposeframeshift mistranslation, A6TDepositorInsertsGFPmut2
mScarlet-I
UseReporterTagsExpressionBacterialMutationFrameshift insertion 6AAAAAATPromoterPtet+dnaK P1Available sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v1
Plasmid#97081PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v1
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSDMA66
Plasmid#128355PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorInsertNoureothricin (NAT)
UseUnspecifiedTagsExpressionMutationPromoterACT1Available sinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSDMA67
Plasmid#128356PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorInsertNoureothricin (NAT)
UseUnspecifiedTagsExpressionMutationPromoterACT1Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
UseTagsNoneExpressionMammalianMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorInsertUPF3A (UPF3A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAW218
Plasmid#113240PurposeE. coli expression vector for untagged E. coli Cas1 + Cas2 with CRISPR array, leader IHF binding site flipDepositorInsertsCas1
Cas2
Leader-repeat
UseTagsExpressionBacterialMutationAAAAAATCATTAATTAATAATAGGTTATG->CATAACCTATTATTA…PromoterAvailable sinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorInsertmiRaSynuclein(human) (SNCA Human)
UseAAV and RNAiTagsExpressionMutationPromoterCAGAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHW1143
Plasmid#229866PurposeEntry vector with FRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA in slot 4 (for SapTrap assembly)DepositorInsertFRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA
UseTagsExpressionWormMutationPromoterAvailable sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6
Plasmid#185506PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsExpressionMutationFSIENIM to AAAAAAMPromoterAvailable sinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only