We narrowed to 6,202 results for: cat.2
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDONR207-MUM2sp-Citrine-ADPG2
Plasmid#170725PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the Citrine and the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)DepositorInsertARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 (PGAZAT Mustard Weed)
UseGateway donor vector / entry cloneTagsCitrine tag (714bp)Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPN260
Plasmid#91581PurposeExpress sgRNA targeting human CLUDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN261
Plasmid#91582PurposeExpress sgRNA targeting human CLUDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINE GFP nanobody:Halo:His6
Plasmid#111090PurposeBacterial expression of a fusion protein consisting of a GFP nanobody (Dr. Brett Collins, Addgene plasmid # 49172), the Halo tag and a His6 tag.DepositorInsertGFP Nanobody
TagsHalo and His6ExpressionBacterial, Insect, and Mamm…PromoterT7 promoterAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL13
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-imp α
Plasmid#119718PurposeExpresses EGFP-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
TagsEGFPExpressionMammalianMutationcontains amino acids 251-529PromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
IL2R/hE-cadherin-cytotail
Plasmid#45773DepositorExpressionMammalianMutationInterleukin-2 receptor α subunit extracellular an…PromoterCMVAvailable SinceJune 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS16
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS14
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mFzd4-opt(40-537)-9xHis_pFastBac1
Plasmid#216378PurposeBaculovirus transfer vector to express FLAG-tagged mouse Fzd4 (codon-optimized for insect cell expression)DepositorInsertFrizzled-4 (Fzd4 Mouse)
UseBaculovirusTagsHA signal sequence-FLAGExpressionInsectPromoterPolyhedrinAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-imp α
Plasmid#119719PurposeExpresses mCherry-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
TagsmCherryExpressionMammalianMutationcontains amino acids 251-529PromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
mOrange-imp α
Plasmid#119720PurposeExpresses mOrange-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
TagsmOrangeExpressionMammalianMutationcontains amino acids 251-529PromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-CTNNB1-Armadillo-HA
Plasmid#242224PurposeExpression of human β-catenin Armadillo repeats (deletion of a.a. 2-133 and a.a. 665-781) using piggyBac transpositionDepositorInsertCTNNB1 (CTNNB1 Human)
UsePiggybacTagsHAExpressionMammalianMutationDeleted N terminal and C terminal IDRs from β-cat…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-5X-1-GST-Armadillo
Plasmid#242225PurposeExpression of GST-tagged human β-catenin Armadillo repeats without IDRs (deletion of a.a. 2-133 and 672-781) in E. coliDepositorInsertCTNNB1 (CTNNB1 Human)
TagsGSTExpressionBacterialMutationDeleted N terminal and C terminal IDRs from β-cat…PromotertacAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only