We narrowed to 4,129 results for: plasmid lenti crispr
-
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-spCas9-WPRE-miR124T
Plasmid#245071PurposeCRISPR Editing with SpCas9, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertCas9, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTJK475
Plasmid#138014PurposeSIX1 CRISPRiDepositorAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_BsmBI-sgRNA-BsmBI
Plasmid#188703PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and a BsmBI array for cloning 4 sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCG-scr
Plasmid#229847PurposeExpresses wild-type Cas9 and scrambled gRNA.DepositorInsertguide RNA with scrambled sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-ACTB-C4
Plasmid#229846PurposeExpresses wild-type Cas9 and gRNA for ACTB gene.DepositorInsertguide RNA for ACTB gene
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTJK459
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-mU6-ACAN-hU6-Col2a1-hUbC-dsRed
Plasmid#241310PurposeLentiviral expression vector encoding for multiplex regulation of ACAN/Col2a1DepositorInsertACAN/Col2a1 gRNA (COL2A1 Human)
UseLentiviralAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO Cre v4 trcr filler
Plasmid#256774Purposelentiviral construct with Cre recombinase and U6 driven gRNA cassette with the v4 modified trcrRNA. gRNAs can be cloned in by digesting the filler with BsmBI.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO H2BmRFP-2A-puro Plgrkt-HA v4 trcr filler
Plasmid#256787Purposelentiviral construct with H2BmRFP-2A-puromycin, Plgrkt-HA, and U6 driven gRNA cassette with the v4 modified trcrRNA. gRNAs can be cloned in by digesting the filler with BsmBI.DepositorAvailable SinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO Cre-2A-Plgrkt K147R v4 trcr filler
Plasmid#256791Purposelentiviral construct with Cre recombinase-2A-Plgrkt K147R and U6 driven gRNA cassette with the v4 modified trcrRNA. gRNAs can be cloned in by digesting the filler with BsmBI.DepositorAvailable SinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO Cre-2A-Plgrkt Δ139-147 v4 trcr filler
Plasmid#256792Purposelentiviral construct with Cre recombinase-2A-Plgrkt Δ139-147 and U6 driven gRNA cassette with the v4 modified trcrRNA. gRNAs can be cloned in by digesting the filler with BsmBI.DepositorAvailable SinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO H2BmRFP-2A-Plgrkt Δ139-147 v4 trcr filler
Plasmid#256784Purposelentiviral construct with H2BmRFP-2A-Plgrkt (mouse) Δ139-147 and U6 driven gRNA cassette with the v4 modified trcrRNA. gRNAs can be cloned in by digesting the filler with BsmBI.DepositorAvailable SinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only