We narrowed to 7,491 results for: RAP
-
Plasmid#196497PurposeExpresses Right-side TALE-DddAtox Nterm half ND4-FusXTBE in mammalian cellsDepositorInsertCOX8A MTS-ND4 right TALE-G1397 DddA-C-UGI-ATP5B 3'UTR
ExpressionMammalianAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 GST MetaP2
Plasmid#112750Purposeexpress HA-GST-FRB-MetaP2DepositorAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-GOLPH3
Plasmid#21688DepositorInsertGolgi Phosphoprotein 3 (GOLPH3 Human)
UseGateway entry cloneMutationlast nucleotide of stop codon removed for c-termi…Available SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMX-IY LC3B
Plasmid#89291PurposeFor expression of the mammalian Atg8 protein LC3B without a tagDepositorAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDR217
Plasmid#113872Purposeexpression of Cas9 programming sgRNA9 and sgRNA10 targetting MPH2-3 and MAL11 respectivelyDepositorInsertsgRNA9-MPH2-3 sgRNA10-MAL11
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 Flag GFP 4E-BP1 Omp25
Plasmid#112760Purposeexpress GFP-4EBP1-Omp25DepositorAvailable SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
p28BIOHTEV-LIC: nsp16_SARS-CoV-2|nsp10_SARS-CoV-2
Plasmid#167848PurposeBacterial expression of the SARS-CoV-2 proteins nsp10 and nsp16 from a bicistronic mRNADepositorInsertnsp10, nsp16
Tags6xHis and AviTagExpressionBacterialPromoterT7Available SinceApril 22, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pURD214
Plasmid#113871Purposeexpression of Cas9 programming sgRNA5 and sgRNA2 targetting HXT13-15-16 and HXT2 respectivelyDepositorInsertsgRNA5 HXT13-15-16 sgRNA2-HXT2
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR220
Plasmid#113873Purposeexpression of Cas9 programming sgRNA8 and sgRNA7 targetting HXT10 and HXT9-11-12 respectivelyDepositorInsertsgRNA8-HXT10 sgRNA7-HXT9-11-12
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR295
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
zgc:153086_R (OZ512)
Plasmid#27187DepositorInsertZinc finger array targeting zgc:153086
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
zgc:153086_L (OZ511)
Plasmid#27186DepositorInsertZinc finger array targeting zgc:153086
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
SDC3_L (OZ595)
Plasmid#35235DepositorInsertZinc finger array targeting SDC3
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
SDC3_R (OZ596)
Plasmid#35236DepositorInsertZinc finger array targeting SDC3
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-NRCAM 12950 (VL + VH) synNotch
Plasmid#247509PurposeExpresses a synNotch receptor using a scFvs binding to NrCAM (neural cell adhesion molecule)DepositorInsertsynNotch binding to NrCAM (neural cell adhesion molecule)
UseLentiviralExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Thy1.1-Aoah
Plasmid#233141PurposeThy1.1 and Aoah overexpressionDepositorInsertAcyloxyacyl hydrolase (Aoah Mouse)
UseLentiviralAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-PTPRZ CA-FNIII domain 13069 (VH+VL) synNotch
Plasmid#247524PurposeExpresses a synNotch receptor binding to PTPRZDepositorInsertsExpresses a synNotch receptor binding to PTPRZ
Expresses a synNotch receptor binding to PTPRZ
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-PTPRZ CA-FNIII domain 13069 (VL+VH) synNotch
Plasmid#247523PurposeExpresses a synNotch receptor binding to PTPRZDepositorInsertExpresses a synNotch receptor binding to PTPRZ
UseSynthetic BiologyExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-NRCAM 12955 (VH+VL) synNotch
Plasmid#247512PurposeExpresses a synNotch binding to NrCAM (neural cell adhesion molecule)DepositorInsertExpresses a synNotch binding to NrCAM (neural cell adhesion molecule)
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-PTPRZ CA-FNIII domain 13062 (VH+VL) synNotch
Plasmid#247522PurposeExpresses a synNotch receptor binding to PTPRZDepositorInsertExpresses a synNotch receptor binding to PTPRZ
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV- MOG-VHVL-M38-synNotch-Gal4VP64
Plasmid#247501PurposeExpresses a synNotch binding to myelin oligodendrocyte glycoproteinDepositorInsertExpresses a synNotch binding to myelin oligodendrocyte glycoprotein
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV- MOG-VHVL-M38-synNotch-Gal4VP64
Plasmid#247502PurposeExpresses a synNotch binding to myelin oligodendrocyte glycoproteinDepositorInsertsynNotch receptor using a scFvs binding to MOG
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-NRCAM 12955 (VL + VH) synNotch
Plasmid#247511PurposeExpresses a synNotch binding to NrCAM (neural cell adhesion molecule)DepositorInsertExpresses a synNotch binding to NrCAM (neural cell adhesion molecule)
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-PTPRZ CA-FNIII domain 13062 (VL+VH) synNotch
Plasmid#247521PurposeExpresses a synNotch receptor binding to PTPRZDepositorInsertExpresses a synNotch receptor binding to PTPRZ
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR Gal4-UAS_3XFlag_4D5-5_CAR-mCherry_pGK_BFP
Plasmid#247572PurposeGAL4/UAS expression of a CAR against HER2 and mCherry with constitutive BFPDepositorInsertGAL4/UAS expression of a CAR against HER2 - mCherry and BFP constitutive
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-p120RasGAP-714-1047-WT
Plasmid#245307PurposeExpresses GAP domain of human p120RasGAP (residues 714-1047 wild type) in E. coliDepositorInsertRASA1 (RASA1 Human)
Tags6HisExpressionBacterialMutationdeleted amino acids 1-713PromoterT7lacAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-p120RasGAP-581-1047-WT
Plasmid#246487PurposeExpresses C2 and GAP domains of human p120RasGAP (residues 581-1047 wild type) in E. coliDepositorInsertRASA1 (RASA1 Human)
Tags6HisExpressionBacterialMutationdeleted amino acids 1-580PromoterT7lacAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW281_dSpRY
Plasmid#244822PurposeMammalian expression of catalytically inactive SpRY Cas9 (dSpRY)DepositorInsertdSpRY Cas9
UseCRISPRTags3xFLAG-SV40 NLS and Nucleoplasmin NLSExpressionMammalianMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterCAGAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only