We narrowed to 6,013 results for: ATC
-
Plasmid#215878PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-589(3p)-WT (MIR589 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-376a2(3p)-WT
Plasmid#215879PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-376a2(3p)-WT (MIR376A2 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-99a-WT
Plasmid#215880PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-99a-WT (MIR99A Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-376a1(5p)-I-type
Plasmid#215882PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of 376a1(5p)-I-type (MIR376A1 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-22(3p)-I-type
Plasmid#215886PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-22(3p)-I-type (MIR22 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-376a2(3p)-I-type
Plasmid#215887PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-376a2(3p)-I-type (MIR376A2 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-99a-I-type
Plasmid#215888PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-99a-I-type (MIR99A Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-FXR1-G266E
Plasmid#225482PurposeExpress epegRNA for FXR1DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luciferase shRNA-TRE
Plasmid#225339PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertLuciferase shRNA (LOC116160065 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_2
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP782_Traptavidin-KRAB-CO
Plasmid#211775PurposeAviTag counterpart binding domain, Traptavidin, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertSpyCatcher-DNMT3A
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceFeb. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211696PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-3_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211698PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211690PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp-exon minimal CMV pCDNA5
Plasmid#212084PurposeLR vector for integration of Sap30bp-exon_siResist into N2a FRT rtTA3 expression cellsDepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only