We narrowed to 27,277 results for: Tat
-
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
UseTagsExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-SRT1
Plasmid#203171PurposeYeast expression vector for yeast SRT1DepositorInsertSRT1 (SRT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterTDH3Available sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
PDE4B-Sensor
Plasmid#208929Purposein vitro JNK-Sensor for luminescent detection of JNK-activityDepositorInsertPDE4B docking sequence+Phospho site and Smbit (PDE4B Human)
UseTagsHISx6, MBP, and SmbitExpressionBacterialMutationPromoterT7Available sinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorInsertOpen Reading Frame 6 (ORF6 SARS-CoV-2)
UseTagsALFAExpressionMammalianMutationPromoterCMVAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halotag-6xHp
Plasmid#214414PurposeLipid droplet localization of 6xHp of Spastin fused to HalotagDepositorInsert6x Spastin aa 43-92 (SPAST Human)
UseTagsHaloExpressionMammalianMutationPromoterCMVAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
mApple-1xHp
Plasmid#214409PurposeLipid droplet and ER localization of 1xHp of Spastin fused to mAppleDepositorInsertSpastin aa 43-92 (SPAST Human)
UseTagsmAppleExpressionMammalianMutationPromoterCMVAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1015A
Plasmid#213415PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnTS-E1015A (VCL Synthetic, Chicken)
UseTagsExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1021A
Plasmid#213416PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnTS-E1021A (VCL Synthetic, Chicken)
UseTagsExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1015A
Plasmid#213412PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnCS-E1015A (VCL Synthetic, Chicken)
UseTagsExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1021A
Plasmid#213413PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnCS-E1021A (VCL Synthetic, Chicken)
UseTagsExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
Plasmid#206967PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA7.10, SpG N
UseAAVTagsExpressionMutationPromoterCMVAvailable sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA8e-SpG N aa2-713-InteinN
Plasmid#206968PurposeExpresses TadA8e and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA8e, SpG N
UseAAVTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033D
Plasmid#211893PurposeVinculin tension sensor (VinTS) with vinculin S1033 phosphomimetic point mutation (S1033D), in lentiviral expression vector.DepositorInsertVinculinTS-S1033D (VCL Synthetic, Chicken)
UseLentiviralTagsExpressionMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinCS-S1033A
Plasmid#211894PurposeVinculin conformation sensor (VinCS) with vinculin S1033 unphosphorylatable point mutation (S1033A), in lentiviral expression vector.DepositorInsertVinculinCS-S1033A (VCL Synthetic, Chicken)
UseLentiviralTagsExpressionMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinCS-S1033D
Plasmid#211895PurposeVinculin conformation sensor (VinCS) with vinculin S1033 phosphomimetic point mutation (S1033D), in lentiviral expression vector.DepositorInsertVinculinCS-S1033D (VCL Synthetic, Chicken)
UseLentiviralTagsExpressionMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033A
Plasmid#211835PurposeVinculin tension sensor (VinTS) with vinculin S1033 unphosphorylatable point mutation (S1033A), in lentiviral expression vector.DepositorInsertVinculinTS-S1033A (VCL Synthetic, Chicken)
UseLentiviralTagsExpressionMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
MIGR1_FLAG_TAL1-long_dt tomato
Plasmid#210639PurposeOverexpression of TAL1-longDepositorInsertTAL1-long (TAL1 Human)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V222A RAD23B
Plasmid#201580PurposeExpresses a variant of human RAD23B containing mutation V222A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
UseTagsFLAGExpressionMammalianMutationContains mutation V222APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F400A RAD23B
Plasmid#201581PurposeExpresses a variant of human RAD23B containing mutation F400A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
UseTagsFLAGExpressionMammalianMutationContains mutation F400APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG/ATP8B3-HA
Plasmid#209211PurposeMammalian expression of ATP8B3DepositorInsertATP8B3 (ATP8B3 Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
ALIX(P801G)-mNeonGreen
Plasmid#191192PurposeFull-length ALIX with P801G mutation in proline-rich domain; C-terminally tagged with mNeonGreen.DepositorInsertALIX (P801G) (PDCD6IP Human, Synthetic)
UseTags6xHIS and mNeonGreenExpressionMammalianMutationPro 801 mutated to GlyPromoterCMVAvailable sinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
1533_pAAV-CB-AcGFP-BirA-HA
Plasmid#208201PurposeControl for FKBP12-BirA constructDepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterChicken beta actinAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-GFP
Plasmid#205179PurposeExpresses rat CENP-O C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorInsertCENP-O (Cenpo Rat)
UseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationWild type rat CENP-OPromoterT7Available sinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB399
Plasmid#203635PurposeModule for the expression of geneticin resistance, Nluc under PgpdA promoter and luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertFB367+FB396
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX SYT9 C2B D330, 332N
Plasmid#195705PurposeBacterial expression plasmid encoding GST-tagged SYT9 C2B domain with D330, 332N mutationsDepositorInsertSyt9 (Syt5 Mouse)
UseTagsGSTExpressionBacterialMutationencodes amino acids 253-344 of mouse SYT9 with D3…PromoterAvailable sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX SYT9 C2AB D197,199,330,332N
Plasmid#195706PurposeBacterial expression plasmid encoding GST-tagged SYT9 C2AB domain with D197, 199, 330, 332N mutationsDepositorInsertSyt9 (Syt5 Mouse)
UseTagsGSTExpressionBacterialMutationencodes amino acids 104-386 of mouse SYT9 with D1…PromoterAvailable sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB400
Plasmid#203636PurposeModule for the expression of geneticin resistance, Nluc under PgpdA promoter and luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertFB367+FB397
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NUS1
Plasmid#203169PurposeYeast expression vector for yNUS1DepositorInsertNUS1 (NUS1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterTDH3Available sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2
Plasmid#203164PurposeYeast expression vector; To express proteins under control of TDH3 promoter and terminator using methionine selectionDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
1BR9-AtWUSSTOP
Plasmid#202053PurposeE. coli expression vector for N-ter GFP11 tagged Arabidopsis thaliana WUSCHELDepositorInsertAtWUS E. Coli Codon Optimized (WUS Mustard Weed)
UseTags6xHis and GFP11ExpressionBacterialMutationPromoterT7 PromoterAvailable sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYG215
Plasmid#200837PurposeTranscribes a glmZ' (1-146)-gfp fusion. gfp can be replaced via AgeI/XbaI-sites with gene of interest to release its RNA with a 5' monophosphate upon cleavage.DepositorInsertglmZ (glmZ Escherichia coli str. K-12 substr. MG1655)
UseSynthetic BiologyTagsGFPExpressionBacterialMutationPromoterP-LlacO-1Available sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMM7
Plasmid#201213PurposeIntegrative GFP-based shuttle vector for genetic engineering of Parageobacillus thermoglucosidasius. Carries homologous flanks for deletion of key sporulation regulator spo0A.DepositorInsertssfGFP
Spo0A right flank
Spo0A left flank
UseSynthetic BiologyTagsExpressionBacterialMutationF11V, T13P, N39D, A179APromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-RER2
Plasmid#203170PurposeYeast expression vector for yeast RER2DepositorInsertRER2 (RER2 Budding Yeast)
UseTagsExpressionYeastMutationPromoterTDH3Available sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-GlcisPT
Plasmid#203172PurposeYeast expression vector for Giardia cis-prenyltransferaseDepositorInsertUPPS
UseTagsExpressionYeastMutationPromoterTDH3Available sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CALPAIN-7 residues 1-165, V18D
Plasmid#180612PurposeBacterial expression for CALPAIN-7 MIT domains, residues 1-165. Has V18D mutation. Has N-terminal HIS-SUMO tag. Internal ID: WISP21-26.DepositorInsertCALPAIN-7
UseTagsHIS-SUMOExpressionBacterialMutationResidues 1-165, V18D mutationPromoterT7Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CALPAIN-7 residues 1-165, F98D
Plasmid#180613PurposeBacterial expression for CALPAIN-7 MIT domains, residues 1-165. Has F98D mutation. Has N-terminal HIS-SUMO tag. Internal ID: WISP21-27.DepositorInsertCALPAIN-7
UseTagsHIS-SUMOExpressionBacterialMutationResidues 1-165, F98D mutationPromoterT7Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-CSE1L neo
Plasmid#192341PurposeLentiviral expression vector for an inducible 3xFLAG-CSE1LDepositorInsertCSE1L (CSE1L Human)
UseLentiviralTags3xFLAGExpressionMutationPromoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only