We narrowed to 6,013 results for: ATC
-
Plasmid#199636PurposesgRNA guide against VRK2DepositorInsertN/A (VRK2 Human)
UseLentiviralAvailable SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRPA_sgRNA2
Plasmid#201623PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRPA (SNRPA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet pLKO.1-shCse1l v1 puro
Plasmid#192342PurposeLentiviral expression vector for an inducible shCse1L v1DepositorInsertshCse1l v1 (Cse1l Budding Yeast)
UseLentiviralAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mNudcd3 - 1
Plasmid#198501Purposelentiviral stable expression of mNudcd3 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mRab12-2
Plasmid#198476Purposelentiviral stable expression of mRab12 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoter2x35S promoter and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197960PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by UBQ10 gene promoter and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgAP2M1 guide 2
Plasmid#193601PurposeAP2M1 knockoutDepositorInsertsgAP2M1 guide 2 (AP2M1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shSrpk3-1
Plasmid#180400PurposeProducing AAV that encodes mouse Srpk3 shRNA-1 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shSrpk3-3
Plasmid#180402PurposeProducing AAV that encodes mouse Srpk3 shRNA-3 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-2
Plasmid#180392PurposeProducing AAV that encodes mouse Stk16 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-PBD-GFP-U6ac-rac2 guides
Plasmid#168251Purpose"label active Rac under Rac2 neutrophil-specific knockout background"DepositorInsertPBD GFP
UseZebrafish expressionPromoterLyzCAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Utrophin-GFP-U6ac-Rac2 guides
Plasmid#168254Purpose"label stable F-actin under Rac2 neutrophil-specific knockout background"DepositorInsertUtrophin-GFP
UseZebrafish expressionPromoterLyzCAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hU6-sgNT3 (opti)
Plasmid#177239PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses non-targeting gRNADepositorInsertsgNT3
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMETn_2 (inducible)
Plasmid#189954PurposeshRNA mediated knockdownDepositorInsertERV_MMETn
UseLentiviralAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMERVK9c_2 (inducible)
Plasmid#189958PurposeshRNA mediated knockdownDepositorInsertERV_MMERVK9c
UseLentiviralAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only