We narrowed to 5,202 results for: Mos;
-
Plasmid#229705PurposeTransient expression of GFP-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+
Plasmid#229697PurposeTransient expression of GFP-alpha-cateninA+ in mammalian cells; enhanced actin bindingDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+ΔβH
Plasmid#229704PurposeTransient expression of GFP-alpha-cateninA+deltabetaH in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I acceptor only control (F40-based tension sensor)
Plasmid#119189PurposeThe acceptor (mEYFP) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration or with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin I-[mTFP1(Y72G)-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-TMPRSS2-TwinStrep_Zeo
Plasmid#192000PurposeLentiviral vector to generate TwinStrep-tagged TMPRSS2 stable expressing cell lineDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYX-N-Puro-mNeon-WNK3
Plasmid#222674Purposeendogenously tag WNK3 with N-terminal mNeonDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I affinity mutant (F40-based tension sensor)
Plasmid#119190PurposeThe affinity mutant for the F40-based human desmoplakin I tension sensor incorporates a point mutation that exhibits enhanced keratin association.DepositorInserthuman Desmoplakin I(S2849G)-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+
Plasmid#229703PurposeLentiviral expression of iRFP670-alpha-cateninA+ in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-ePhi29 fusion - pCMV-T7-PCV2-ePhi29 (JO1420)
Plasmid#217805PurposeUnfused click editor construct expressing PCV2-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-TRE-V5-TurboID-linker-T2A-GR-bGH polyA > mPGK-BlastR-SV40 polyA
Plasmid#218910PurposePiggyBac transpositionDepositorInsertV5-TurboID-T2A-huGR/BlastR (NR3C1 Human)
ExpressionMammalianMutation2363G>C and 4155C>T and 4729T>G and 4731…Available SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQC hGAB.wt V5-His IRES G418
Plasmid#110333PurposeMammalian retroviral expression of glutaminase 2 isoform GAB (wild type) with V5 and 6xHis tagsDepositorInsertGLS2 Glutaminase 2 (GLS2 Human)
UseRetroviralTags6xHis and V5ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TOPO mMecp2-NLucTom
Plasmid#159282PurposeTo tag endogenously and c-terminally mouse Mecp2 with two reporters: NanoLuciferase and TdTomato. It contains 2 homology arms from a castaneus background surrounding the STOP codon.DepositorInsertMecp2 (Mecp2 Mouse)
TagsNluciferase-P2A-TdTomatoExpressionMammalianMutationNluciferase-TdTomato fusionAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
ACTIN-Cxcl5-PGK-Cre
Plasmid#110278PurposeBicistronic lentivirus expressing Cxcl5 and CreDepositorInsertsUseCre/Lox and LentiviralTagsNo fusion genesExpressionMammalianMutationWild typePromoterB-actin and PgkAvailable SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V1 O-Glycosylation site
Plasmid#120406Purposeenables eukaryotic expression of human plasma fibronectin in which the third O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N), V1 and V2 Glycosylation sites
Plasmid#120407Purposeenables eukaryotic expression of human plasma fibronectin in which all three O-glycosylation sites were mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with mutations …PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based tension sensor)
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only