We narrowed to 13,664 results for: 109
-
Plasmid#113762PurposeAAV-mediated conditional expression of bacterial tdNfsB-mCherry (eNTR) under the CAG promoterDepositorInserttdNfsB(F124W)-mCherry
UseAAV and Cre/LoxTagsmCherryExpressionMammalianMutationF124WPromoterCAGAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF-DEST51 GFP-PNRC1
Plasmid#123295PurposeMammalian expression of PNRC1 N-GFPDepositorAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-Orai1
Plasmid#89818PurposeExpress Orai1 in mammalian cellsDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO-EGFP-G3BP1-S149A
Plasmid#136004PurposeDOX-inducible S149A G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK8-His-myc-Rbx1
Plasmid#29506DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1899)
Plasmid#170143PurposeExpresses residues 1-1899 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1900-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1547)
Plasmid#170144PurposeExpresses residues 1-1547 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1548-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (K999R)
Plasmid#170142PurposeExpresses CHD7 (K999R) in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
Tags6xHis and FLAGExpressionInsectMutationK999RAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_GATAD2A
Plasmid#86279PurposeDonor vector for 3' FLAG tag of human GATAD2ADepositorAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
aav-SYN-FLEX-tdNfsB(F124W)-mCherry (eNTR)
Plasmid#113763PurposeAAV-mediated conditional expression of bacterial tdNfsB-mCherry (eNTR) under the SYN promoterDepositorInserttdNfsB(F124W)-mCherry
UseAAV and Cre/LoxTagsmCherryExpressionMammalianMutationF124WPromoterSynapsinAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-hBAI3-HormR-GAIN
Plasmid#37848DepositorInsertBAI3 (BAI3 Human)
UseBaculovirus transfer vectorsTags8xHISMutationHormR and GAIN domains only (aa498–868PromoterPolyhedrinAvailable SinceJuly 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 EBNA1BP2
Plasmid#67072PurposeStandard for cell-free expression benchmarking.DepositorInsertEBNA1BP2 EBNA1BP2 EBNA1 binding protein 2 (EBNA1BP2 Human)
UseCell-free expressionTagsEGFP and HisPromoterT7Available SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
mVenus-RnBarr1
Plasmid#137796PurposeVisualization of beta-arrestin1DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClβ.CreON
Plasmid#196996PurposeCre recombinase dependent expression of GluClv2.0 beta subunit. GluClβ contains a YFP tag. When co-expressed with GluClv2.0 alpha subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClβ -YFP
UseAAV and Cre/LoxTagsYFPPromotershort CAGAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
ath5:H2B-RFP
Plasmid#105960Purposetransgenesis, appears rather late, likely due to long RFP maturation time but is brighter than most other Ath5 constructDepositorAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET23a_mod_RBPMS_FL
Plasmid#59393PurposePlasmid for bacterial overexpression of RBPMSDepositorAvailable SinceFeb. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP
Plasmid#183926PurposeOptogenetic PHR domain coupled to GFP; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
NG1237 pCI-TPI-PTC160-4H
Plasmid#65804PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianMutationpremature stop codon at 160PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MDH1-shDusp5-2-H2Kb2
Plasmid#17853DepositorAvailable SinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits only