We narrowed to 11,805 results for: NSI;
-
Plasmid#223510PurposeFluorescent reporter plasmid for genetic code expansion which consists of a modified GFP with a Amber stop codon on position Y39DepositorInsertGFP(Y39TAG)
Tags6xHis and FLAGExpressionBacterialMutationY39TAGAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAUC40
Plasmid#71298PurposeSuicide Vector, Gateway attR-Chloramphenicol resistance cassette cloned in pKNG101DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2 Flag-JunB
Plasmid#29687DepositorAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_45bpLinker
Plasmid#157791PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 45 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_45bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET30a-GlmU-NahK-ET64
Plasmid#234663PurposeExpression an ELP-tagged fusion enzyme of GlmU and NahKDepositorInsertsN-acetylglucosamine- 1-phosphate uridyltransferase
N-acetylhexosamine 1-kinase
TagsELPExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pARF6-CFP
Plasmid#11382DepositorAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_Puro_sgTP53
Plasmid#187819PurposepLentiCRISPR that is selectable with puromycin with an sgRNA targeting TP53DepositorInsertsgTP53
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE80l BCB
Plasmid#196472PurposeProtein expression of SpyCatcher-ELP-CarHC-ELP-SpyCatcher, with TEV cleavage site and MMP cleavage site respectively before and after each SpyCatcherDepositorInsertBCB
ExpressionBacterialPromoterT7Available SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8702 pHR-TRE3G-AcrVA1-EF1a-sfGFP-T2A-rtta-WPRE
Plasmid#140229PurposeDox-inducible expression of anti-Cpf1 AcrVA1. Constitutive EF1a driven rtTA and GFPDepositorInsertAntiCRISPR protein AcrVA1
UseLentiviralExpressionMammalianPromoterTRE3GAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLPCX-PECAMTS
Plasmid#45850DepositorAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
PAmCherry1-N1-Tubbyc
Plasmid#202677PurposePhotoactivatable lipid biosensorDepositorInsertMus musculus Tub (243-505): PAmCherry1 (Tub Mouse)
ExpressionMammalianAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMN-333
Plasmid#195467PurposeLentiviral Integratable Inducible synZiFTR ZF3 + ReporterDepositorInsertinverted[8X ZF3 BS - ybTATA - mCherry] - pSFFV - ZF3 - p65 - ERT2
UseLentiviralExpressionMammalianAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHCA/GAL4(1-93).ER.VP16
Plasmid#108216PurposeYeast expression vector for fusion of Gal4 DNA binding domain to estrogen receptor alpha hormone binding domain to VP16 transcriptional activation domainDepositorInsertGal4 DBD-ERalpha HBD-VP16
ExpressionYeastMutationERalpha HBD has G400V mutationPromoterADH1Available SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
EKAREN5-gl
Plasmid#225958PurposeThe YPet and mTurquoise sequence cassettes in EKAREN5(Addgene 167821) were replaced with a synonymous codon variant of YPet and mTurquoise-gl and subcloned into pCSII lentiviral backbone.DepositorInsertEKAREN5-gl
UseLentiviralTagsnls localization motifExpressionMammalianPromoterEF-1-alpha promoterAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-SisTnpB1–ωRNA
Plasmid#228365PurposeExpresses SisTnpB1 and RNP complex in E. coli Rosetta (DE3) cellsDepositorInsertSisTnpB1
ExpressionBacterialPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSW181 - GR-LhG4
Plasmid#115983Purposeentry vector for GreenGate cloning method, CDSDepositorInsertGR-LhG4
UseUnspecifiedAvailable SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-mtagBFP-2A
Plasmid#102585PurposeControl lentivector. Coexpression of mTagBFP and gene of interest from SFFV promoterDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only