We narrowed to 21,470 results for: SPR
-
Plasmid#86839Purposemamalian expression of AcrIIA1DepositorInsertacrIIA1
ExpressionMammalianPromoterCMVAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_hup53_Ex4
Plasmid#85538PurposeInducible expression of guide RNA (hup53_Ex4) with fluorescent GFP reporterDepositorInserthup53 Ex4
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIND20-KNL1-s24a_s60a-dCas9
Plasmid#248563PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertKNL1-s24a_s60a-dCas9
UseCRISPRTagsHA, 2xNLSExpressionMammalianMutationKNL1 S24A, S60A; Cas9 D10A, H840APromoterTRE, miniCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-ACTB
Plasmid#227320PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorInsertACTB Homology Arms flanking a Puro-2A-mStayGold Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-mScarlet-ACTB
Plasmid#207753PurposeDonor template for Blast-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mScarlet Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-mNeon-ACTB
Plasmid#207752PurposeDonor template for Puro-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK90 pHomL-TEF2p-Scarlet(rfp)-Link-2xPH-SSA1t-HomR (AmpR)
Plasmid#179074PurposeVector containing a yeast integration cassette for expressing TEF2p-Scarlet(rfp)-Link-2xPH, an overexpressed (bright) marker for the plasma membraneDepositorInsertTEF2p-Scarlet(rfp)-Link-2xPH
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK86 pHomL-RPL18Bp-preCOX4-Link-Scarlet(rfp)-SSA1t-HomR (AmpR)
Plasmid#179070PurposeVector containing a yeast integration cassette for RPL18B-driven expression of preCOX4-Link-Scarlet(rfp), a marker for the mitochondriaDepositorInsertRPL18Bp-preCOX4-Link-Scarlet(rfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK84 pHomL-RPL18Bp-PDR16-Link-Scarlet(rfp)-SSA1t-HomR (AmpR)
Plasmid#179068PurposeVector containing a yeast integration cassette for RPL18B-driven expression of PDR16-Link-Scarlet(rfp), a marker for the lipid dropletDepositorInsertRPL18Bp-PDR16-Link-Scarlet(rfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK83 pHomL-RPL18Bp-ERG6-Link-Scarlet(rfp)-SSA1t-HomR (AmpR)
Plasmid#179067PurposeVector containing a yeast integration cassette for RPL18B-driven expression of ERG6-Link-Scarlet(rfp), a marker for the lipid dropletDepositorInsertRPL18Bp-ERG6-Link-Scarlet(rfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK82 pHomL-RPL18Bp-Scarlet(rfp)-Link-ATG8-SSA1t-HomR (AmpR)
Plasmid#179066PurposeVector containing a yeast integration cassette for RPL18B-driven expression of Scarlet(rfp)-Link-ATG8, a marker for the autophagosomeDepositorInsertRPL18Bp-Scarlet(rfp)-Link-ATG8
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK79 pHomL-RPL18Bp-Scarlet(rfp)-Link-YPT7-SSA1t-HomR (AmpR)
Plasmid#179063PurposeVector containing a yeast integration cassette for RPL18B-driven expression of Scarlet(rfp)-Link-YPT7, a marker for the vacuole, late endosomeDepositorInsertRPL18Bp-Scarlet(rfp)-Link-YPT7
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK76 pHomL-RPL18Bp-PIL1-Link-Scarlet(rfp)-SSA1t-HomR (AmpR)
Plasmid#179060PurposeVector containing a yeast integration cassette for RPL18B-driven expression of PIL1-Link-Scarlet(rfp), a marker for the eisosomesDepositorInsertRPL18Bp-PIL1-Link-Scarlet(rfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK68 pHomL-RPL18Bp-SRM1-Link-Scarlet(rfp)-SSA1t-HomR (AmpR)
Plasmid#179052PurposeVector containing a yeast integration cassette for RPL18B-driven expression of SRM1-Link-Scarlet(rfp), a marker for the nucleusDepositorInsertRPL18Bp-SRM1-Link-Scarlet(rfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK67 pHomL-RPL18Bp-RPC19-Link-Scarlet(rfp)-SSA1t-HomR (AmpR)
Plasmid#179051PurposeVector containing a yeast integration cassette for RPL18B-driven expression of RPC19-Link-Scarlet(rfp), a marker for the nucleolusDepositorInsertRPL18Bp-RPC19-Link-Scarlet(rfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC011
Plasmid#171143PurposeExpression of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) on pRK2-KmR plasmidDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNAscaffold 2.1 scRNA (GB1437)
Plasmid#160571PurposeVersion of SgRNA scaffold with the sequence 2.1 of Ms2 aptamer in the 3' end.DepositorInsertsgRNAscaffold 2.1 scRNA
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E2 (GB2239)
Plasmid#160561PurposetRNA and scaffold for the assembly of GBoligomers for position [2-3] of a polycistronic tRNA-gRNADepositorInserttRNA-gRNA position E2 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS4 (Empty insertion vector with SEC)
Plasmid#154837PurposeVector that can be modified to add gene(s) of interest to C. elegans ChrII:8420157 site via CRISPR with SEC selectionDepositorInsertSEC
UseCRISPR and Cre/LoxExpressionWormMutationsqt-1(e1350)Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g1)-PGKpuroBFP-W
Plasmid#105037PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g2)-PGKpuroBFP-W
Plasmid#105038PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MPP1 gRNA (BRDN0001148092)
Plasmid#77805Purpose3rd generation lentiviral gRNA plasmid targeting human MPP1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MARK3 gRNA (BRDN0001146658)
Plasmid#77719Purpose3rd generation lentiviral gRNA plasmid targeting human MARK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K2 gRNA (BRDN0001147931)
Plasmid#77603Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MARK2 gRNA (BRDN0001146902)
Plasmid#77592Purpose3rd generation lentiviral gRNA plasmid targeting human MARK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001144763)
Plasmid#77549Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001145195)
Plasmid#77550Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001147587)
Plasmid#77551Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK3 gRNA (BRDN0001145912)
Plasmid#77324Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK3 gRNA (BRDN0001146913)
Plasmid#77325Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRRK2 gRNA (BRDN0001146754)
Plasmid#77330Purpose3rd generation lentiviral gRNA plasmid targeting human LRRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKD1 gRNA (BRDN0001146537)
Plasmid#77228Purpose3rd generation lentiviral gRNA plasmid targeting human PRKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
JAK3 gRNA (BRDN0001145049)
Plasmid#77190Purpose3rd generation lentiviral gRNA plasmid targeting human JAK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PNKP gRNA (BRDN0001147028)
Plasmid#77162Purpose3rd generation lentiviral gRNA plasmid targeting human PNKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001162256)
Plasmid#76929Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only