We narrowed to 5,034 results for: PID
-
Plasmid#166855PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in K683E, H685E, K686E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationK683E, H685E, K686EPromoterpCuAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641E, I645E-Ss(424)
Plasmid#166854PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641E, I645E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationF641E, I645EPromoterpCuAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641G, I645G-Ss(424)
Plasmid#166853PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641G, I645G with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationF641G, I645GPromoterpCuAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1B-mCherry-StreptagII
Plasmid#158744PurposeExpresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-B (KCNK4 Human)
UseTagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-290 and N-linked glycosylation sites r…PromoterAOX1Available sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 T78R L84R T92R V118R
Plasmid#112106PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorInsertDynamin1 (DNM1 Human)
UseTagsEGFPExpressionMammalianMutationT78R L84R T92R V118RPromoterCMVAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-N[80]A
Plasmid#96992PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
UseTagsExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTYB-pLAC-L108S/L109S/F112S
Plasmid#48730PurposeBacterial expression of Lacritin Protein with Mutation at proteins 108 and 109 Leucine to Serine and 112 from phenylalanine to serineDepositorInsertLacritin (LACRT Human)
UseTagsInteinExpressionBacterialMutationLeucine 108 and 109 to Serine; phenylalanine 112 …PromoterT7Available sinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX68
Plasmid#46857PurposeOP Hupki-puro2A-A138V plasmid to indroduce mutant p53 to PLF ESC or MEFs by IMCEDepositorInsertattB-Puro-2A and Hupki p53 A138V (TP53 Mouse, Human)
UseTagsExpressionMammalianMutationp53 A138VPromoterAvailable sinceAug. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP1-C-Flag
Plasmid#134286PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP1DepositorInsertSREBP1 (Srebf1 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP1 isoform a precursorPromoterEF1aAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Puro
Plasmid#79049PurposeExpresses human NEUROGENIN2 (hNGN2) and puromycin resistance gene under control of TetON promoter. This lentiviral vector is used to generate NGN2-iNs (induced neurons) from hiPSCs and hiPSC-NPCs.DepositorInserthNGN2-P2A-PuroR (NEUROG2 Human)
UseLentiviralTagsExpressionMutationPromoterTetOAvailable sinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
OPEN Beta2-microglobulin
Plasmid#215657PurposeE. coli expression of human beta-2-microglobulin containing a cysteine mutation for disulfide linkage to mutant HLA.DepositorInsertOPEN Beta2-microglobulin (B2M Human)
UseTagsExpressionBacterialMutationHistidine 31 to CysteinePromoterT7Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGF-bio-His
Plasmid#53340PurposeExpresses full-length Pro-epidermal growth factor precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertEGF (EGF Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pW17
Plasmid#158207Purpose2lox landing pad plasmid with mariner transposon and transposase used for CRAGEDepositorInsertloxP/Cre/KmR/Lox5171/Mariner IR oriT/transposase
UseTagsExpressionMutationPromoterAvailable sinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF0211
Plasmid#142484PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertFOXP3 (FOXP3 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
PJ-INPP5E
Plasmid#38001DepositorUseTagsmRFPExpressionMammalianMutationCys 779 mutated to SerPromoterAvailable sinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-BTC-ScNeo
Plasmid#209898PurposeTo monitor the status of Betacellulin, the plasmid encodes a recombinant BTC fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertBTC-ScNeo (BTC Human)
UseLentiviralTagsmNeonGreen and mScarletExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-NRG1-ScNeo
Plasmid#209900PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertNRG1-ScNeo (NRG1 Human)
UseLentiviralTagsmNeonGreen and mScarletExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-Bst LF-6xHis
Plasmid#159148Purposeexpresses His-tagged large fragment of Bst polymeraseDepositorInsertlarge fragment of Geobacillus stearothermophilus DNA polymerase I
UseTagsHisExpressionBacterialMutationPromoterAvailable sinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-puro-N-3HA-SREBP2-C-Flag
Plasmid#134287PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP2DepositorInsertSREBP2 (Srebf2 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP2 precursorPromoterCMVAvailable sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only