We narrowed to 8,410 results for: reporter
-
Plasmid#227112PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1092DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1092 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO Dual-Luciferase-MYB-3'UTR
Plasmid#182250PurposeHuman MYB 3` UTR region containing 3x binding sites for miR-150 cloned downstream of luciferase reporter geneDepositorInsert3' UTR region of MYB gene
UseLuciferaseExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-BCL2 3'UTR
Plasmid#84597PurposeRenilla luciferase reporter containing BCL2 3' UTRDepositorAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMTS-hFluc-HA-GFP11
Plasmid#177726PurposeFirefly luciferase reporter fused to a mitochondria signal sequence for mitochondrial targeting with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, and Mitochondrial Targeting SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGH00.0126
Plasmid#64257PurposeBinary T-DNA vector expressing EGFP and neomycin phosphotransferase II (NPTII); for Agrobacterium tumefaciens-mediated transformationDepositorInsertsEGFP
neomycin phosphotransferase II
UseBinary agrobacterium vector for plant transformat…ExpressionPlantPromoterE12-omegaAvailable SinceJune 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-ITGA6-1k-Basic-LUC
Plasmid#107141PurposeLuciferase reporter plasmid to monitor transcriptional activity of canine ITGA6-promoter (1kb fragment)DepositorInsertITGA6-promoter
UseLuciferaseExpressionMammalianAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO Dual-Luciferase-HNRNPAB-3'UTR
Plasmid#182249PurposeHuman HNRNPAB 3` UTR region containing 2x binding sites for miR-150 cloned downstream of luciferase reporter geneDepositorInsert3' UTR region of HNRNPAB gene
UseLuciferaseExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
TC1154
Plasmid#164876PurposeSplit GFP reporter plasmid expressing GFP (b11betaDepositorInsertSplit GFP(beta11)
ExpressionMammalianAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
TC1541A
Plasmid#164875PurposeSplit GFP reporter expressing GFP(beta1-10) following C>U editing of the target siteDepositorInsertSplit GFP(beta1-10)
ExpressionMammalianAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG397
Plasmid#226733PurposeExpresses a reporter for an alpha-helical OMM proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSNRW-Z5-Nluc
Plasmid#174487PurposeRecombinant fusion protein gene combining IgG-Fc binding domain Z (5 repeats) of Staphylococcal Protein A and bioluminescence reporter Nanoluciferase in pET28a bacterial expression plasmid.DepositorInsertZ5-Nluc
Tags6x Histidine tag (N terminal on insert)ExpressionBacterialPromoterT7lac promoterAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-JNKKTRmRuby2
Plasmid#59148PurposeORF encoding JNK KTR mRuby2 flanked by Gateway sequencesDepositorInsertJNK Kinase Translocation Reporter (MAPK8 Mouse, Human)
TagsmRuby2Available SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOPS0381
Plasmid#133231PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter PsNifH (pOGG043), sfGFP (pOGG037) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
12x PRE TK luc
Plasmid#206163PurposeLuciferase reporter construct containing 12 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert12X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MLC2(CA)-IRES-GFP
Plasmid#133928PurposeBicistronic vector for the expression of EGFP reporter and untagged constitutive active myosin II light chainDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Renilla luciferase-Pol III
Plasmid#37380DepositorInsertPolIII-Renilla control reporter (RpIII128 Fly)
UseLuciferaseExpressionMammalianPromoterRNA PolIII 128 subunit (RpIII128)Available SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Camk2a
Plasmid#186818PurposeFluorescent reporter for Camk2a expressionDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Camk2b
Plasmid#186819PurposeFluorescent reporter for Camk2b expressionDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGl3-Camk2g
Plasmid#186821PurposeFluorescent reporter for Camk2g expressionDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGG Wheat GUS marker
Plasmid#165418PurposeWheat transformation binary vector pGGG confers hygromycin resistance in wheat and contains the GUS (2x introns) reporter gene driven by OsUbi promoterInsertOs Ubiquitin Promoter::Gus (2x introns)::NosT
UseWheat transformation binary vectorPromoterOS UbiP::GUS (2xint)::NosTAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-IGK-dAPEX2-KDEL
Plasmid#117183PurposePlasmid name in publication: pAAV-DIO-ER-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labelingDepositorInsertIGK-dAPEX2-KDEL
UseAAV and Cre/LoxExpressionMammalianMutationW41F and A134P on soybean APXPromoterEF1aAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPS0382
Plasmid#133232PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter PsNifH (pOGG043), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEPZ
Plasmid#111161PurposemiR-E (miR-30 variant)-based RNAi with ZsGreen reporterDepositorInsertmiR-E (miR-30 variant)
UseRetroviralMutationWTAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Equalizer-L episome
Plasmid#169738PurposeEqualizer-L on an episomal vector. This plasmid encodes eGFP to report circuit output levels. This plasmid also encodes a separate mCherry expression cassette to monitor plasmid dosage.DepositorInsertmiR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
UseSynthetic BiologyExpressionMammalianPromoterpCMV-tetO2Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRAB18-GFP
Plasmid#106984PurposeABA signaling reporter, GFP under the RAB18 promoterDepositorInsertsGFP
ExpressionPlantPromoterRAB18Available SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-FUCCI-Luc
Plasmid#133364PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with FUCCI cell cycle reporterDepositorInsertClover-Geminin-IRES-mKO2-Cdt1
TagsHA-tagged Clover-GemininExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIL6-Nluc-hbb
Plasmid#239843PurposeTemplate for in vitro transcription of secreted nanoluciferase, with interleukin 6 signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertSecreted nanoluciferase, with interleukin 6 signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only