We narrowed to 5,792 results for: actin
-
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
MCU-mCherry
Plasmid#232790PurposeEncodes an mCherry-tagged MCU/Mitochondrial Calcium UniporterDepositorInsertCalcium uniporter protein, mitochondrial (MCU )
TagsmCherryExpressionMammalianPromoterCMVAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZG61
Plasmid#202575PurposeRNA editing in plants. Plasmid contains 35S-dADARcd-LIC1-ccdB-LIC2-35S-hptIIDepositorInsertHyperADARcd
ExpressionPlantMutationE488QAvailable sinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNVLTv2-pvdIJD-Ptrc-base
Plasmid#169243PurposeSuicide vector for integrating expression cassette in P. putida (IPTG induction)DepositorInsertlacI
ExpressionBacterialPromoterlacIqAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
kermit/pCS2+
Plasmid#16309DepositorInsertKermit (gipc1 Frog)
UseVertebrate expressionAvailable sinceDec. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
kermit-2/pCS2+
Plasmid#16314DepositorInsertKermit 2 (gipc2 Frog)
UseVertebrate expressionAvailable sinceDec. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-HA-GFP11-KDEL
Plasmid#177722PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
actc1b-actn2-mKate2
Plasmid#109751PurposeMuscle specific zebrafish expression of mKate2 fused to alpha actinin 2DepositorInsertalpha actinin 2
UseZebrafish plasmidsTagsmKate2Available sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
GRIP1
Plasmid#38884PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPS934
Plasmid#8855DepositorAvailable sinceAug. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
PHIPA
Plasmid#74665PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
PhOTO-C (pMTB:cyto-Dendra2-2A-H2B-Cerulean)
Plasmid#92402PurposeConstitutive expression of cytosolic green-to-red photoconvertible Dendra2 and the nuclear blue fluorescent protein Cerulean.DepositorInsertsDendra2
Cerulean
UseZebrafish expressionTagsH2B tag and No tag, cytosolic expressionPromoterbactin2Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Hook3 aa 1-239
Plasmid#74609PurposeExpresses Hook domain and first coiled coil of Hook3 in bacteria for purificationDepositorInserthuman Hook3 amino acids 1-239 (HOOK3 Human)
Tags6x His, Strep II, and superfolder GFPExpressionBacterialAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PDIK1L
Plasmid#23738DepositorInsertPDIK1L (PDIK1L Human)
UseGateway CloningAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
Cntn6-AP-His
Plasmid#71944PurposeExpresses the extracellular region of the Contactin 6 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-838;+80pCalb2
Plasmid#66750Purposeluciferase reporter for Calb2 promoter (-838 to +80, WT)DepositorInsertCalb2 promoter (-838bp +80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available sinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-PHYHIP
Plasmid#31578DepositorInsertphytanoyl-CoA hydroxylase interacting protein (PHYHIP Human)
TagsHis and TEVExpressionBacterialAvailable sinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only