We narrowed to 16,633 results for: OMP;
-
Plasmid#115844PurposeEncodes codon optimized FLAG tagged SIVRCM-VpxDepositorInsertSIVRCM-Vpx
Tags3x-FLAGExpressionMammalianPromoterCMVAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Smad5-3'UTR
Plasmid#61777PurposeLuciferase reporter containing the 3'UTR of mouse Smad5DepositorInsertmouse Smad5 3'UTR
UseLuciferaseAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGF008
Plasmid#48848PurposeProvides a BASTA resistance cassette as GreenGate module.DepositorInsertpNOS::BastaR::tNOS
UseGolden gate compatible cloning vectorMutationchi sequence in BastaR removed by silent substitu…Available sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
psiCHECK SIRT4 3'UTR
Plasmid#19860DepositorInsertSIRT4 3' UTR (SIRT4 Human)
ExpressionMammalianAvailable sinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-Ezr-eGFP
Plasmid#176856PurposeExpresses Ezrin fused with eGFP at the C-terminus in astrocytesDepositorInsertEzr-GFP
UseAAVTagsGFPExpressionBacterialPromotergfaABC1DAvailable sinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-29b(+)-mSandy2
Plasmid#177760PurposeExpresses mSandy2 using the T7 PromoterDepositorInsertmSandy2
Tags6xHis tagExpressionBacterialPromoterT7 PromoterAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-cDAXX
Plasmid#169729PurposeBacterial expression of N-terminally 6His tagged cDAXXDepositorAvailable sinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW149
Plasmid#122248PurposepTYB2 containing TIF4631 gene, expresses yeast eIF4G1 as an intein-chitin-binding domain fusion for purification of untagged full-length protein, with or without a fluorescent label on the C-terminus.DepositorInsertTIF4631 (TIF4631 Budding Yeast)
TagsIntein-Chitin-binding domainExpressionBacterialPromoterT7Available sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSR358.4
Plasmid#125114PurposeExpression of narL(1-159aa)-liaR(154-211aa) chimera under PLtetO-1, output Promoter PliaI121DepositorInsertsnarL(REC)-liaR(DBD)159
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKD279
Plasmid#125099PurposeExpression of SO_4388(1-130aa)-psdR(134-237aa), ompR137 chimera under PLtetO-1, output Promoter PpsdA110DepositorInsertsSO_4388(REC)-psdR(DBD)137
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable sinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPS0254
Plasmid#115506PurposeReporter plasmid suitable for experiments in environments where there is no antibiotic selection present. Symbiosis-induced nifH promoter from Rhizobium leguminosarum biovar vicia 3841 (Rlv3841pNifH) expressing celBDepositorInsertRlv3841pNifH pOGG082, celB pOGG050, T-pharma pOGG003 assembled in pOGG026
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable sinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-HA/Bmal L95E
Plasmid#47344PurposePcHA-Bmal backbone used for the above mutation. Ref.Genes & Dev 17:1921-1932 2003DepositorAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMP117
Plasmid#207920PurposeGreenBraid destination vector pGBZ2 - PaqCI - Eco31I - spisPink- Eco31I - PaqCIDepositorTypeEmpty backboneExpressionPlantAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BECN1
Plasmid#203568PurposeMammalian expression of BECN1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBECN1 (BECN1 Human)
ExpressionMammalianPromoterCMVAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOmniBac zz TEV YBBR POT1
Plasmid#185444PurposeExpresses human POT1 with a zz affinity tag, YBBR labeling site, and TEV cleavage site in insect cellsDepositorAvailable sinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUdioFRTeYFPW
Plasmid#133998Purposeexpresses eYFP upon coexpression with the recombinase flippase (Flp)DepositorInserteYFP
UseLentiviral; Flp/frtExpressionMammalianMutationinverted and flanked by two incompatible FRT site…PromoterUbCAvailable sinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Z-VCP-10
Plasmid#166559PurposescFv of a human scaffold targeting Transitional endoplasmic reticulum ATPase. Antigen coverage aa 1-806 of 806, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mTurquoise2-UtrCH
Plasmid#98824PurposeIn vivo visualization of actin cytoskeleton (can be used for colocalization studies)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUtrCH
TagsmTurquoise2ExpressionMammalianPromoterCMVAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_Q331K
Plasmid#98673PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with Q331KDepositorAvailable sinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only