We narrowed to 4,463 results for: erf
-
Plasmid#180316Purposemammalian expression of human SEPT7 Gmut1 fused to monomeric superfolder GFPDepositorInsertSEPTIN7 (SEPTIN7 Human)
TagsmsfGFPExpressionMammalianMutationSEPT7 W269A, H279DPromoterCMVAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3 NCmut-msfGFP
Plasmid#180325Purposemammalian expression of human SEPT9_i3 NCmut fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v3 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i3 I263D, M270DPromoterCMVAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPV00914 pET21GG2 H6-TF-BECN (1-450) [VA-MA-LA]
Plasmid#136688PurposeExpresses the full-length Beclin-1 protein (a.a. 1-450) with a N-terminal hexa-Histidine and solubility tag (i.e., Trigger Factor). Three mutations are added to the CC and ECD/BARA interface.DepositorInsertBeclin-1 (BECN1 Human)
TagsTrigger FactorExpressionBacterialMutationDNA optimized for E. coli expression w/ three mut…PromoterT7Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_12
Plasmid#60319PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS C18orf26)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_14
Plasmid#60321PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS CCRN4L)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-SZ158a QTY
Plasmid#162442PurposeExpression in E coli and perform ligand binding in solutionDepositorInsertC-X-C chemokine receptor type 4 (CXCR4 Human)
Tagshis-tag, Rho-tagExpressionBacterialMutationAll L, I, V, F in the transmembrane region mutate…AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-SZ146a QTY
Plasmid#162443PurposeExpression in E coli and perform ligand binding in solutionDepositorInsertC-X-C chemokine receptor type 4 (CXCR4 Human)
Tagshis-tag, Rho-tagExpressionBacterialMutationAll L, I, V, F in the transmembrane region mutate…AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-SUMO1nc-PURO
Plasmid#208035PurposeEnables inducible expression of C-terminal Split-TurboID-fused SUMO1nc, to perform SUMO-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-mXFPm-IFNGR1(18-489)
Plasmid#192786PurposeExpression of mXFPm-tagged IFNGR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNGR1 (IFNGR1 Human)
TagsIg k-chain leader sequence and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-45: TTN-mEGFP
Plasmid#114412PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TTN, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertTTN Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (TTN Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-mXFPe-IFNGR2(30-337)
Plasmid#192787PurposeExpression of mXFPe-tagged IFNGR2 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNGR2 (IFNGR2 Human)
TagsIg k-chain leader sequence and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_15
Plasmid#60322PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS PHLDA1) (PHLDA1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBig1a zz TEV YBBR POT1 MBP TEV TPP1 MBP TEV TIN2 ZZ TEV TRF2 (4comp2)
Plasmid#185448PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF2 with a zz tag and TEV site, and human TIN2 and TPP1 each with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectMutationSee Depositor Comments BelowAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPe-IFNAR1(28-557)
Plasmid#187844PurposeExpression of SNAPf and mEGFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPe…ExpressionMammalianMutationmeGFPe: asparagine 198 to aspartic acid and tyros…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-beta-actin
Plasmid#231548PurposeMammalian expression of human beta actin fused to C-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCjedCas9
Plasmid#172216PurposeExpresses catalytically inactive Campylobacter jejuni Cas9 (CjedCas9) in bacterial cellsDepositorInsertcatalytic mutant of Cas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagMutationchanged Asp 8 to Ala and His 559 to AlaAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K197R-VA
Plasmid#191223PurposeLentiviral expression of human IFIT5_K197R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationchanged Lysine 197 to Arginine (K197R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only