We narrowed to 11,082 results for: CHL
-
Plasmid#169184PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag and nsp7-Linker-nsp8 fusion in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7-Linker-nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus) and nsp7-nsp8 fusi…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-3xFlag/nsp7-His6-nsp8 (SARS-CoV-2)
Plasmid#169183PurposeBaculoviral transfer vector to co-express nsp12-3xFlag and nsp7-His6-nsp8 fusion in insect cellsDepositorInsertnsp12-3xFlag/nsp7-His6-nsp8 (ORF1ab SARS-CoV-2)
Tags3xFlag (nsp12 C-terminus) and His6 (as internal t…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1784 - pAAV SYN1 hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201820PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cavbeta1 Ca2+ channel [N7/18.1R]
Plasmid#114497PurposeMammalian Expression Plasmid of anti-Cavbeta1 Ca2+ channel (Human). Derived from hybridoma N7/18.1.DepositorInsertanti-Cavbeta1 Ca2+ channel (Home sapiens) recombinant mouse monoclonal antibody (CACNB1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BAP1_p.N299S
Plasmid#81572PurposeGateway Donor vector containing BAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BAP1_p.D75G
Plasmid#81526PurposeGateway Donor vector containing BAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cavbeta1 Ca2+ channel scFv [N7/18]
Plasmid#206789PurposeMammalian Expression of Cavbeta1 Ca2+ channel scFV. Derived from hybridoma N7/18 scFv.DepositorInsertCavbeta1 Ca2+ channel (Homo sapiens) recombinant scFV (CACNB1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 5 Spacer
Plasmid#172733PurposeEncodes Part 5 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 4 Spacer
Plasmid#172732PurposeEncodes Part 4 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 3 Spacer
Plasmid#172731PurposeEncodes Part 3 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1 Spacer
Plasmid#172729PurposeEncodes Part 1 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1b Spacer
Plasmid#172728PurposeEncodes Part 1b of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1a Spacer
Plasmid#172727PurposeEncodes Part 1a of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav1.2 pS1928 [L132/80R]
Plasmid#225371PurposeMammalian Expression Plasmid of anti-Cav1.2 (Mouse) IgG2a R-mAb. Derived from hybridoma L132/80.DepositorInsertAnti-Cav1.2 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Cacna1c Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav1.2 pS1928 [L132/76R]
Plasmid#225370PurposeMammalian Expression Plasmid of anti-Cav1.2 (Mouse) IgG2a R-mAb. Derived from hybridoma L132/76.DepositorInsertAnti-Cav1.2 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Cacna1c Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cavbeta1 Ca2+ channel [N7/18R-2b]
Plasmid#206676PurposeMammalian Expression Plasmid of anti-Cavbeta1 Ca2+ channel (Human). Derived from hybridoma N7/18-2b.DepositorInsertanti-Cavbeta1 Ca2+ channel (Homo sapiens) recombinant Mouse monoclonal antibody (CACNB1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL
Plasmid#203176PurposeCentromeric yeast expression vector, leucine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBig2ab zz TEV YBBR POT1 ZZ TEV TPP1 MBP TEV TIN2 ZZ TEV TRF1 (4comp1)
Plasmid#185447PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF1 and TPP1 each with a zz tag and TEV site, and human TIN2 with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cavbeta1 Ca2+ channel [N7/18R-rat IgG2a] - Chimeric
Plasmid#231836PurposeMammalian expression plasmid of anti-Cavbeta1 Ca2+ channel (Human) rat IgG2a R-mab. Derived from hybridoma N7/18.DepositorInsertAnti-Cavbeta1 Ca2+ channel (Homo sapiens) recombinant mouse monoclonal antibody (CACNB1 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAP1
Plasmid#63674PurposeAccepts DNA sequences via BpiI cloning sites, resulting in Level 0 standard parts for Golden Gate cloning. Parts can be released with a user-defined 4-base-pair, 5 prime overhangs using BsaI.DepositorInsertRFP cloning selection cassette
UseSynthetic BiologyAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-SNAPf DHC1_IC2C_LIC2_Tctex1_Robl1_LC8
Plasmid#111903PurposeFull length human cytoplasmic dynein 1 complex, optimised for Sf9 expression. 8xHis-ZZ tag followed by TEV cleavage site and SNAPf tag on the N-terminus of dynein heavy chain 1.DepositorInsertsTags8xHis, SNAPf-tag, TEV site, and ZZ-tagExpressionInsectMutationOptimised for expression in Sf9 cells.Available SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only