We narrowed to 10,763 results for: ESP
-
Plasmid#22999DepositorAvailable SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pQCXIB Flag MFF WT
Plasmid#74384PurposeRetroviral expression vector containing Flag tagged WT MFF isoform 5DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1GZmbh
Plasmid#44516DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
GST-SF3B2 wild type aa 401-550 fragment
Plasmid#67615Purposebacterial expression of wild type GST-SF3B2 fragment (401-550)DepositorInsertsplicing factor 3b subunit 2 (SF3B2 Human)
TagsGSTExpressionBacterialMutationfragment of amino acids 401-550PromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(30Q)-S776D
Plasmid#21755DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 32 amino acids (30 Q…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA p21 K161Q, K163Q
Plasmid#78790PurposeTo overexpress p21 K161Q, K163Q in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLINK cyclin T1 (1-280) myc (all 200) (P#575)
Plasmid#14610DepositorInsertcyclin T1 (1-280) (all 200) (CCNT1 Human)
TagsmycExpressionMammalianMutationC198A, C200A, H202A, C205A. Active in 3T3 cells.Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAN19-3xFLAG-TIR1-NOSt
Plasmid#108545PurposeCloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with 3xFLAG and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTags3xFLAGAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso1 S172A
Plasmid#74391PurposeFlag tagged human S172A MFF isoform 1 mutantDepositorInsertFlag-MFF (MFF Human)
TagsFlagExpressionMammalianMutationdelta exon 1 (1-26) and Ser 172 Ala.Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-SF3B2 R508K aa 401-550 fragment
Plasmid#79674Purposebacterial expression of GST-SF3B2 fragment (401-550) with R508L methylation site mutationDepositorInsertsplicing factor 3b subunit 2 (SF3B2 Human)
TagsGSTExpressionBacterialMutationaa 451-550 with R508KPromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-LPPRC
Plasmid#48167Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsertLRPPRC leucine rich pentatricopeptide repeat containing (Lrpprc Human)
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG182 FGFR1 3'UTR mut
Plasmid#12009DepositorInsertN15 3'UTR mut (FGFR1 Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-MKK7-EE-NLS hygro
Plasmid#87780PurposeInducible expression of constitutively active mutant MKK7 with a C-terminal NLS sequenceDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCELF PAI-RBP v3
Plasmid#45507DepositorAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso4 S172A
Plasmid#74393PurposeFlag tagged human S172A MFF isoform 4 mutantDepositorInsertFlag-MFF (MFF Human)
TagsFlagExpressionMammalianMutationSer 172 Ala (numbering based on MFF isoform 1)Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(84Q)-S776A
Plasmid#21758DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 84 Q(Glutamines) and…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(30Q)-S776A
Plasmid#21756DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 32 amino acids (30 Q…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFRT-B-RPCNA (pc1205)
Plasmid#247000PurposeThis pFRT-B plasmid enables the creation of a stable mammalian cell line expressing RFP-tagged PCNA .DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFRT-B-GPCNA (pc1274)
Plasmid#247001PurposeThis pFRT-B plasmid enables the creation of a stable mammalian cell line expressing GFP-tagged PCNADepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-His-GFP-RAD54L2
Plasmid#247924PurposeInsect expression construct for N-terminal His-GFP-tagged RAD54L2DepositorAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C14A, C439A)-flag-tev-halo-his
Plasmid#227162PurposeFor T-REX experiments of CYP2A6 C14A and C439A double mutant. Less sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 14 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-cyp-33e1(C295A, C439A)-flag-tev-halo-his
Plasmid#227158PurposeFor T-REX experiments of cyp-33e1 C295A and C439A double mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertcyp-33e1 (cyp-33E1 Nematode)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 295 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C439A)-flag-tev-halo-his
Plasmid#227161PurposeFor T-REX experiments of CYP2A6 C439A mutant. Less sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C82A, C439A)-flag-tev-halo-his
Plasmid#227163PurposeFor T-REX experiments of CYP2A6 C82A and C439A double mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 82 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-LG4_chr5:550kb antisense
Plasmid#205468PurposeEnhancer containing plasmid used for assessing enhancer::promoter interactionsDepositorInsertchr5:550kb LG4
UseSynthetic Biology; Subcloning of taq-amplified pc…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only