We narrowed to 14,467 results for: cas9 genes
-
-
pCPH3.2-GS3
Plasmid#204763PurposeExpression of Cas9 and human H3.2DepositorInsertH3.2 (HIST2H3PS2 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.L-GS3
Plasmid#204756PurposeExpression of Cas9 and human H2A.LDepositorInsertH2AL3 (H2AC6 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV152
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV51
Plasmid#179915PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern332
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 gRNA17 (FWA)
Plasmid#120250PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg17_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJB172
Plasmid#86992PurposeCRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1DepositorInsertgRNA targeting pil1
ExpressionYeastAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV1064
Plasmid#247972PurposeCRISPR-Cas9 vector containing two 20 nt protospacer sequences to target the gene wA in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-wA-gRNA 1 & 2-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMG005_mNeonGreen_P2A
Plasmid#237215PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmNeonGreen-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMG008_mCherry_P2A
Plasmid#237216PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmCherry-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
UC20m
Plasmid#121040PurposeMoClo golden gate assembly DE part for gN2 gRNA (guide RNA for S. pyogenes Cas9; sequence designed with NUPACK for stable tracrRNA structure and open targeting region).DepositorInsertgN2 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC49
Plasmid#104823PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma17g11235 (Dcl4a). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma17g11235
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC38
Plasmid#104812PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC37
Plasmid#104811PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only
