We narrowed to 12,276 results for: shRNA
-
-
EZH2 E9.3 gRNA
Plasmid#90684Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-KRAS-G12C-tmpknot-epegRNA
Plasmid#214094PurposeLentiviral vector expressing epegRNA to induce KRAS G12C mutationDepositorInsertKRAS G12C epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shSmad4
Plasmid#37046DepositorAvailable SinceJan. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP1
Plasmid#183323PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP1 geneDepositorInsertTOP1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E1.3 gRNA
Plasmid#90880Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E10.3 gRNA
Plasmid#90685Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PXN
Plasmid#227315PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2
Plasmid#25752PurposeEntry vector for cloning miR30-based shRNA driven by TRE-tight promoter.DepositorTypeEmpty backboneUseEntry vectorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1A
Plasmid#183337PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_C
Plasmid#72622PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA-leu-HYB
Plasmid#64332Purposeleu2 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of leu2 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A6.5 gRNA
Plasmid#90569Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only
