We narrowed to 10,765 results for: ESP
-
Plasmid#177772PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (S374A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1_Hygro(+)_GRHL1-K592A-L3F6H
Plasmid#177773PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (K592A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gucy1b2-IRES-nlsCre-IRES-taulacZ-FNF TV
Plasmid#105196Purposetargeting vector to generate a Gucy1b2-IRES-nlsCre-IRES-taulacZ mouse strain.DepositorInsertGucy1b2-IRES-nlsCre-IRES-taulacZ-FNF (Gucy1b2 Mouse)
UseMouse TargetingAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1(Y128F)
Plasmid#177141PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1(Y128F) with a TEV protease site located between the GST tag and NQO1(Y128F)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_A37C-A44C
Plasmid#162582PurposeExpresses norovirus GI.1 VP1 protein with mutations A37C-A44C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAlanine 37 changed to Cysteine and Alanine 44 cha…PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q141V-P221L
Plasmid#162584PurposeExpresses norovirus GI.1 VP1 protein with mutations Q141V-P221L in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 141 changed to Valine and Proline 221 c…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_L144C-P221C
Plasmid#162585PurposeExpresses norovirus GI.1 VP1 protein with mutations L144C-P221C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationLeucine 144 changed to Cysteine and Proline 221 c…PromoterpolyhderinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_G131C-N172C
Plasmid#162586PurposeExpresses norovirus GI.1 VP1 protein with mutations G131C-N172C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlycine 131 changed to Cysteine and Asparagine 17…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N167C-L169C
Plasmid#162587PurposeExpresses norovirus GI.1 VP1 protein with mutations N167C-L169C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 167 changed to Cysteine and Leucine 16…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307Y-pKK223
Plasmid#131381PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307Y in Gs MutY.DepositorInsertEcNGsC MutY chimera F307Y
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-pKK223
Plasmid#131382PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308V-pKK223
Plasmid#131393PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.DepositorInsertEcNGsC MutY chimera S308V
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308A-pKK223
Plasmid#131394PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA p21 K163R
Plasmid#78787PurposeTo overexpress p21 K163R in Mammalian CellsDepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA p21 K161R
Plasmid#78788PurposeTo overexpress p21 K161R in Mammalian CellsDepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN19-TIR1-GUS-NOSt
Plasmid#108547PurposeCloning vector including C-terminally GUS-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with GUS and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTagsGUSAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN19-ccvTIR1-GUS-NOSt
Plasmid#108548PurposeCloning vector including C-terminally GUS-tagged Arabidopsis auxin receptor TIR1 with the F79G mutation [ccvTIR1] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with GUS and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTagsGUSMutationChanged F79 to GAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX-6MYC p21 1-89
Plasmid#78784PurposeTo overexpress p21 1-89 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-192-Reporter
Plasmid#71872PurposeMammalian expression vector for the analysis of miR-19α activityDepositorInsertReverse complementary sequence of miR-192
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-193a-5p-Reporter
Plasmid#71873PurposeMammalian expression vector for the analysis of miR-193a-5p activityDepositorInsertReverse complementary sequence of miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-31-192-193a-Reporter
Plasmid#71874PurposeMammalian expression vector for the analysis of miR-31-19α-193a activityDepositorInsertBinding sequence targeted by miR-31, miR192, and miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc Separase delta 55/Non-Cleavable
Plasmid#59827PurposeAllows the integration of myc Separase delta 55/Non-Cleavable in the genome and Tet-inducible expression.DepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationdelta 55/Non-Cleavable (E1483R, R1486E, E1503R, R…Promoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 4
Plasmid#45387DepositorInsert6 copies of hPAI-1 promoter -732/-721 four point mutation (SERPINE1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated from agacaaggttgt to acactaggatgaAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only