We narrowed to 35,392 results for: CaS;
-
Plasmid#199471PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-AAVS1-sg
Plasmid#194721Purposepx458 with guide RNA that target hAAVS1DepositorArticleAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_mTagBFP2_synCoTC
Plasmid#199474PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_mTagBFP2_synCoTC
Plasmid#199472PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINO4-NLS-Pfv-Sapphire-HO
Plasmid#203660PurposeYeast vector encoding donor DNA for integration of nuclear 40nm GEMs into the HO locus.DepositorArticleInsertPfV
UseCRISPRTagsSapphireAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_mKate2_synCoTC
Plasmid#199470PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_mTagBFP2_synCoTC
Plasmid#199473PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTF1.1.0-gDNA
Plasmid#113797PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MTF1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-TMPRSS2-A6
Plasmid#188690PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R
Plasmid#185060PurposeEf1a driven PE2 plasmid with pegRNA for editing C201R mutation in KCNQ2 gene. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hMYC
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pX459-puro-hPKAalpha
Plasmid#185379PurposeFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alphaDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_DNMT3B
Plasmid#72365PurposeDonor vector for 3' FLAG tag of human DNMT3BDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330_SMAD exon 2 gRNA
Plasmid#68350Purposepx330 with gRNA towards SMAD exon 2. Cas9 is expressed from a CAG promoter.DepositorInsertSMAD exon 2 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_DNMT3B
Plasmid#72366PurposeEncodes gRNA for 3' target of human DNMT3B along with Cas9 with 2A GFPDepositorInsertDNMT3B (DNMT3B Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330_P53 exon 8 gRNA
Plasmid#68349Purposepx330 with gRNA towards P53 exon 8. Cas9 is expressed from a CAG promoter.DepositorInsertP53 exon 8 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330_P53 exon 7 gRNA
Plasmid#68351Purposepx330 with gRNA towards P53 exon 7. Cas9 is expressed from a CAG promoter.DepositorInsertP53 exon 7 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-BCL2L1-A1
Plasmid#188692PurposesgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g2
Plasmid#153016PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing mCherryDepositorInsertTMPRSS2 gRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGRHL2-donor
Plasmid#176351PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330_PTEN exon 5 gRNA
Plasmid#68348Purposepx330 with gRNA towards PTEN exon 5. Cas9 is expressed from a CAG promoter.DepositorInsertPTEN exon 5 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCREB5-donor
Plasmid#132521PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2B-donor
Plasmid#113823PurposeCRISPR donor plasmid to tag human transcription factor TFAP2B with GFPDepositorInsertTFAP2B homology arms flanking EGFP-IRES-Neo cassette (TFAP2B Human)
UseCRISPRMutationUnknownAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12-donor
Plasmid#113802PurposeCRISPR donor plasmid to tag human transcription factor ZBTB12 with GFPDepositorInsertZBTB12 homology arms flanking EGFP-IRES-Neo cassette (ZBTB12 Human)
UseCRISPRMutationrs9267664, rs9267663Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5.1.0-gDNA
Plasmid#112399PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB5DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g3
Plasmid#153017PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing mCherryDepositorInsertTMPRSS2 gRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-CTBP2-MGMT_1
Plasmid#136419PurposeLentiviral expression of gRNAs targeting intron 1 of human CTBP2 and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(CTBP2)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZFX.1.0-gDNA
Plasmid#112462PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFXDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF436.1.0-gDNA
Plasmid#113767PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF436DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTSHZ2-donor
Plasmid#113810PurposeCRISPR donor plasmid to tag human transcription factor TSHZ2 with GFPDepositorInsertTSHZ2 homology arms flanking EGFP-IRES-Neo cassette (TSHZ2 Human)
UseCRISPRAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXD1.1.0-gDNA
Plasmid#112446PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MXD1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXD1-donor
Plasmid#112350PurposeCRISPR donor plasmid to tag human transcription factor MXD1 with GFPDepositorInsertMXD1 homology arms flanking EGFP-IRES-Neo cassette (MXD1 Human)
UseCRISPRMutationhg38:2:69937537:A>C,rs3771530Available SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUSF2.1.0-gDNA
Plasmid#112457PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor USF2DepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF423-donor
Plasmid#113822PurposeCRISPR donor plasmid to tag human transcription factor ZNF423 with GFPDepositorInsertZNF423 homology arms flanking EGFP-IRES-Neo cassette (ZNF423 Human)
UseCRISPRAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF331.1.0-gDNA
Plasmid#112461PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF331DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB11-donor
Plasmid#112348PurposeCRISPR donor plasmid to tag human transcription factor ZBTB11 with GFPDepositorInsertZBTB11 homology arms flanking EGFP-IRES-Neo cassette (ZBTB11 Human)
UseCRISPRMutationhg38:3:101651181:A>TAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVEZF1.1.0-gDNA
Plasmid#112437PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor VEZF1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF416.1.0-gDNA
Plasmid#112468PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF416DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNFXL1.1.0-gDNA
Plasmid#112451PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NFXL1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOVOL1.1.0-gDNA
Plasmid#113794PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor OVOL1DepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCB30
Plasmid#111910PurposeExpresses gRNA to target URA3 knockout locus and has KanMX markerDepositorInsertgRNA cassette targeting URA3 knockout locus
UseCRISPRExpressionBacterial and YeastPromoterSNR52pAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMDuoGreen_Crop-Seq-H2B-GFP-WPRE-TS-hU6-BsmbI
Plasmid#242159PurposeEmpty lentiviral backbone for generation of ClonMapper Duo Green (H2B-GFP) gRNA barcode library for use with polyA capture or gRNA capture scRNA-seq technologiesDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMDuoRed_Crop-Seq-H2B-mCherry-WPRE-TS-hU6-BsmbI
Plasmid#242160PurposeEmpty lentiviral backbone for generation of ClonMapper Duo Red (H2B-mCherry) gRNA barcode library for use with polyA capture or gRNA capture scRNA-seq technologiesDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA101
Plasmid#245323PurposeCas9 CRISPRa positive control guide; targets CD274DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_510
Plasmid#245337PurposeCas9 CBE positive control guide; targets CD274DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_509
Plasmid#245336PurposeCas9 ABE positive control guide; targets CD274DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only