We narrowed to 32,890 results for: CMV
-
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only
-
p35.pA.NGFR.mCMV.hPGK.mSrtA(Pasqual)TM.WPRE[sequenced]
Plasmid#226760Purposesortase A (Pasqual)- TM in p36DepositorInsertsortase A (srtA )
ExpressionMammalianAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-human cGASdeltaN-OMM
Plasmid#186887PurposeExpression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal MAVS transmembrane domain fusion (Adamts1 Synthetic, Human)
UseLentiviralMutationN-terminal truncation, MAVS transmembrane domain …PromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-orangutan cGASdeltaN-OMM
Plasmid#186888PurposeExpression of orangutan cGAS gene in mammalian cells by retroviral transductionDepositorInsertOrangutan cGAS truncation mutant (158-521 a.a.) with C-terminal MAVS transmembrane domain fusion (CGAS Pongo abelii, Synthetic)
UseLentiviralMutationN-terminal truncation, MAVS transmembrane domain …PromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-SV40NLS-OgeuIscBE193A-3XHA
Plasmid#222861PurposeThis plasmid codes for the OgeuIscB nickaseDepositorInsertOgeuIscB Nickase
UseCRISPRTags3X HA and Nucleoplasmin NLS and ITR2ExpressionMammalianMutationE193A for nickase mutationPromoterCMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV:: NES-FKBP-iLID-LRP6c(△1-64)
Plasmid#221775PurposeExpresses NES-FKBP-iLID-LRP6c(△1-64) component in mammalian cellsDepositorInsertpCMV:: NES-FKBP-iLID-LRP6c
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Loxp-CMV-Loxp-GFP-LA
Plasmid#206199PurposeExpresses GFP-lamin-A only in non-myocyte when delivered into mice carrying a cardiomyocyte-specific Myh6-Cre transgeneDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DNAJC5-ΔC30 (Δ169-198)
Plasmid#205722PurposeMammalian expression of DNAJC5-ΔC30 (Δ169-198)DepositorAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plx208-CMV-SspB-EGFP-VP16
Plasmid#213532PurposeExpresses one of the split transcription factor component in mammalian cellsDepositorInsertSspB-EGFP-VP16
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mScarlet-I-eDHFR-ORP5(ΔPH)
Plasmid#214277PurposeMammalian expression of ORP5(ΔPH) fused to mScarlet-I-tagged E. coli DHFRDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
3'-BirA*-FLAG minimal CMV pCDNA5
Plasmid#212047PurposeLR destination vector for integration into N2a rtTA3 expressing cells with an FRT site in the Rosa26 locusDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-BirA*-FLAG minimal CMV pCDNA5
Plasmid#212046PurposeLR destination vector for integration into N2a rtTA3 expressing cells with an FRT site in the Rosa26 locusDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG GFP minimal CMV pCDNA5
Plasmid#212086PurposeLR vector for integration of GFP into N2a FRT rtTA3 expression cellsDepositorInsertGFP
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-XPACK-DNAJC5 (L115R)- HaloTag
Plasmid#205712PurposeMammalian expression of XPACK-DNAJC5 (L115R)-HaloTagDepositorAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DEAD XPACK-DNAJC5 (L115R)
Plasmid#205718PurposeMammalian expression of DEAD XPACK-DNAJC5 (L115R)DepositorAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DNAJC5-ΔC10 (Δ189-198)
Plasmid#205720PurposeMammalian expression of DNAJC5-ΔC10 (Δ189-198)DepositorAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DNAJC5-ΔC20 (Δ179-198)
Plasmid#205721PurposeMammalian expression of DNAJC5-ΔC20 (Δ179-198)DepositorAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DNAJC5-ΔC40 (Δ151-198)
Plasmid#205723PurposeMammalian expression of DNAJC5-ΔC40 (Δ151-198)DepositorAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLv-CMV(trunc)-Parkin-A92mKO2
Plasmid#213549PurposeLentiviral vector for stable low expression of Parkin, internally tagged with mKO2DepositorAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only