We narrowed to 156,064 results for: ins
-
Plasmid#153520PurposeNew color variant of Fucci (Fluorescent ubiquitination-based cell cycle indicator) : Fucci(SA)5.DepositorInserttFucci(SA)5.
TagsAzaleaB5-hCdt1(30/120)_P2A_h2-3-hGem(1/110)ExpressionBacterial and MammalianPromoterCAGAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lact-C2-GFP
Plasmid#22852DepositorAvailable SinceJan. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLBac-FluB-trimer
Plasmid#229859PurposeInfluenza B/Memphis/13/03 polymerase heterotrimer (self-cleaving polyprotein)DepositorInsertsPA, Influenza B (B/Memphis/13/03)
PB1, Influenza B (B/Memphis/13/03)
PB2, Influenza B (B/Los Angeles/1/02)
Tags2x-Streptag and 8xHis-tagExpressionInsectAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDM1513
Plasmid#108998Purposesafe haven knock-in plasmid for the act5 locus, N-terminal GFP taggingDepositorTypeEmpty backboneUseSafe haven knock-in plasmid for the act5 locus, n…TagsGFPAvailable SinceJuly 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-NBid-PhoCl2c-CBid
Plasmid#164051PurposeOptogenetic manipulation of cell apoptosis using PhoCl2cDepositorInsertNBid-PhoCl2c-CBid
Tagskozak sequenceExpressionMammalianPromoterCMV promotorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)IRES GFP
Plasmid#51406PurposeExpresses GFP from internal ribosome entry sequence, cloning componentDepositorInsertIRES GFP
ExpressionMammalianPromoterCMVAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
MCP-EGFP-PiggyBac
Plasmid#190003PurposeExpression of MCP-EGFP in mammalian cells. To clone this plasmid, Addgene plasmid #119908 was used. We replaced the tandem coat proteins and double tagRFP with a single coat protein fused to EGFP.DepositorInsertMCP-EGFP
Available SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBad-LgBiT-PhoCl1-SmBiT-MBP
Plasmid#164034Purposeluciferase-based PhoCl screening constructDepositorInsertLgBiT-PhoCl1-SmBiT-MBP
TagsHis tag, T7 tag, Xpress TagExpressionBacterialPromoteraraBad promotorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcNDA-NES-PhoCl2c-mCherry
Plasmid#164037PurposeOptogenetic control of protein localization by PhoCl2cDepositorInsertNES-PhoCl2c-mCherry
Tagskozak sequenceExpressionMammalianPromoterCMV promotorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 mCherry-NLS
Plasmid#58476PurposeExpresses a nuclear-targeted mCherry control construct, on a CMV reporterDepositorInsert3X NLS with 3X stop codons
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-NBid-mMaple-CBid
Plasmid#164049PurposeOptogenetic manipulation of cell apoptosis negative controlDepositorInsertNBid-mMaple-CBid
Tagskozak sequenceExpressionMammalianPromoterCMV promotorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G
Plasmid#167935PurposeInducible CRISPRi expressionDepositorInsertKRAB-dCas9-DHFR
UseLentiviralPromotertetONAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(4/5FTrp)RS
Plasmid#207620PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 4-Fluoro-L-Tryptophan (4FTrp) and 5-Fluoro-L-Tryptophan (5FTrp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
IL-8 toehold switch sensor
Plasmid#111908PurposeToehold switch sensor to detect IL-8 mRNA with GFP outputDepositorInsertIL8 toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Calprotectin S100A9 toehold switch sensor
Plasmid#110717PurposeToehold switch sensor to detect Calprotectin S100A9 mRNA with GFP outputDepositorInsertCalprotectin S100A9 toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
CXCL5 toehold switch sensor
Plasmid#111907PurposeToehold switch sensor to detect CXCL5 mRNA with GFP outputDepositorInsertCXCL5 toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Oncostatin M toehold switch sensor
Plasmid#111909PurposeToehold switch sensor to detect Oncostatin M mRNA with GFP outputDepositorInsertOncostatin M toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only