We narrowed to 15,889 results for: grna
-
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G8.1 gRNA
Plasmid#90837Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G8.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G7.1 gRNA
Plasmid#90836Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G7.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F10.1 gRNA
Plasmid#90769Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F10.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MCM6 E1.2 gRNA
Plasmid#90762Purpose3rd generation lentiviral gRNA plasmid targeting human MCM6DepositorInsertMCM6 (Guide Designation E1.2)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MASTL F4.1 gRNA
Plasmid#90753Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation F4.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLT3 B3.5 gRNA
Plasmid#90670Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLT3DepositorInsertDYNLT3 (Guide Designation B3.5)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLRB1 H11.3 gRNA
Plasmid#90664Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLRB1DepositorInsertDYNLRB1 (Guide Designation H11.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
TGIF2 A11.3 gRNA
Plasmid#90910Purpose3rd generation lentiviral gRNA plasmid targeting human TGIF2DepositorInsertTGIF2 (Guide Designation A11.3)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
NDUFAB1 C3.3 gRNA
Plasmid#90791Purpose3rd generation lentiviral gRNA plasmid targeting human NDUFAB1DepositorAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
TTK H10.1 gRNA
Plasmid#90923Purpose3rd generation lentiviral gRNA plasmid targeting human TTKDepositorInsertTTK (Guide Designation H10.1)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
NDE1 F1.2 gRNA
Plasmid#90788Purpose3rd generation lentiviral gRNA plasmid targeting human NDE1DepositorInsertNDE1 (Guide Designation F1.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
AURKA A1.1 gRNA
Plasmid#90540Purpose3rd generation lentiviral gRNA plasmid targeting human AURKADepositorInsertAURKA (Guide Designation A1.1)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
CKS2 C8.2 gRNA
Plasmid#90633Purpose3rd generation lentiviral gRNA plasmid targeting human CKS2DepositorInsertCKS2 (Guide Designation C8.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
CCNA1 C8.5 gRNA
Plasmid#90573Purpose3rd generation lentiviral gRNA plasmid targeting human CCNA1DepositorInsertCCNA1 (Guide Designation C8.5)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
H2AFZ B2.3 gRNA
Plasmid#90705Purpose3rd generation lentiviral gRNA plasmid targeting human H2AFZDepositorInsertH2AFZ (Guide Designation B2.3)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
KIF4A D10.2 gRNA
Plasmid#90725Purpose3rd generation lentiviral gRNA plasmid targeting human KIF4ADepositorInsertKIF4A (Guide Designation D10.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
UNG D11.3 gRNA
Plasmid#90936Purpose3rd generation lentiviral gRNA plasmid targeting human UNGDepositorInsertUNG (Guide Designation D11.3)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only