We narrowed to 15,613 results for: grna
-
Plasmid#100566PurposehgRNA-A26 in a lentiviral backboneDepositorInserthgRNA-A26
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_gRNA -hMLHdn-Puro
Plasmid#191105PurposeBackbone for lentiviral pegRNA library construction with hMLH1dn and Puro markerDepositorInserthMLH1dn
UseCRISPR and LentiviralExpressionMammalianMutationI31 silent mutation (ATA to ATC) to remove early …PromoterEF-1aAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-CCR5_DF_B584b_attB
Plasmid#182148PurposeTo insert attB attachment site at CCR5 in human cells via twinPEDepositorInsertCCR5-B584b-attB pegRNA
ExpressionMammalianPromoterhU6Available SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-CCR5_DF_A509b_attB
Plasmid#182147PurposeTo insert attB attachment site at CCR5 in human cells via twinPEDepositorInsertCCR5-A509b-attB pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-evoCjCas9-ABE8e_gRNA
Plasmid#202561PurposehSyn-evoCjCas9-ABE8e and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-ABE8e
UseAAVAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSB-609 U6-sgRNA1 ATCC GGAA
Plasmid#173671PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Ckm_F9
Plasmid#226140PurposeAAV construct for HITI insert with Ckm gRNA and hF9 transgeneDepositorAvailable SinceAug. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLK4 G8.1 gRNA
Plasmid#90837Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G8.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G7.1 gRNA
Plasmid#90836Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G7.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F10.1 gRNA
Plasmid#90769Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F10.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MCM6 E1.2 gRNA
Plasmid#90762Purpose3rd generation lentiviral gRNA plasmid targeting human MCM6DepositorInsertMCM6 (Guide Designation E1.2)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MASTL F4.1 gRNA
Plasmid#90753Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation F4.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLT3 B3.5 gRNA
Plasmid#90670Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLT3DepositorInsertDYNLT3 (Guide Designation B3.5)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLRB1 H11.3 gRNA
Plasmid#90664Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLRB1DepositorInsertDYNLRB1 (Guide Designation H11.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
TGIF2 A11.3 gRNA
Plasmid#90910Purpose3rd generation lentiviral gRNA plasmid targeting human TGIF2DepositorInsertTGIF2 (Guide Designation A11.3)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
NDUFAB1 C3.3 gRNA
Plasmid#90791Purpose3rd generation lentiviral gRNA plasmid targeting human NDUFAB1DepositorAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
TTK H10.1 gRNA
Plasmid#90923Purpose3rd generation lentiviral gRNA plasmid targeting human TTKDepositorInsertTTK (Guide Designation H10.1)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only