We narrowed to 16,006 results for: grna
-
Plasmid#169784PurposeInsert one gRNADepositorTypeEmpty backboneUseUnspecifiedAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
hgRNA-A101_pLKO-Hyg
Plasmid#100569PurposehgRNA-A101 in a lentiviral backboneDepositorInserthgRNA-A101
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
hgRNA-A26_pLKO-Hyg
Plasmid#100566PurposehgRNA-A26 in a lentiviral backboneDepositorInserthgRNA-A26
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-b
Plasmid#87200PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting 5' UTR of HTTDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHTT (HTT Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-a
Plasmid#87201PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting exon 1 of HTTDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHTT (HTT Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2a#1/Cre
Plasmid#173629PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cdkn2a (Cdkn2a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2a#2/Cre
Plasmid#173630PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cdkn2a (Cdkn2a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3047(gRNA XII-1)
Plasmid#73289PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
FISSEQ-hgRNA-Design2
Plasmid#100572PurposeFISSEQ-hgRNA-Design2 in a lentiviral backboneDepositorInsertFISSEQ-hgRNA-Design2
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109314PurposePlasmid for liver-specific expression of AAV SaCas9 with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available sinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
p183_LTJ_sgRNACD90.2_A
Plasmid#82671PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting CD90.2
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
EMX1_sgRNA
Plasmid#100555PurposeExpresses EMX1 sgRNA. Target sequence: GAGTCCGAGCAGAAGAAGAADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEMX1 sgRNA
PromoterU6Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR 2xU6:gRNA pten, mitfa:Cas9
Plasmid#118845PurposeTargets ptena and ptenb and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBbE2k-pTet-gRNAwcaF159
Plasmid#122259PurposeaTc inducible gRNA expression plasmidDepositorInsertgRNAwcaF159
UseSynthetic BiologyAvailable sinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by