We narrowed to 899 results for: Gcat
-
Plasmid#90768Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F9.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MCM2 F6.1 gRNA
Plasmid#90759Purpose3rd generation lentiviral gRNA plasmid targeting human MCM2DepositorInsertMCM2 (Guide Designation F6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D12.1 gRNA
Plasmid#90695Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D12.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
ESPL1 D7.1 gRNA
Plasmid#90682Purpose3rd generation lentiviral gRNA plasmid targeting human ESPL1DepositorInsertESPL1 (Guide Designation D7.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D11.1 gRNA
Plasmid#90694Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ATF7IPi2
Plasmid#59615PurposeExpression of shRNA against human ATF7IPDepositorAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'GAC)
Plasmid#170127PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shControl
Plasmid#180386PurposeProducing AAV that encodes negative control shRNA with miR-E backboneDepositorInsertshControl
UseAAV and RNAiPromoterCBAAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDL691
Plasmid#231166PurposeT-DNA encoding TRV2 with ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESSDepositorInsertipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
ExpressionMammalianAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330A-nBRD4/PITCh
Plasmid#91794PurposePITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4DepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterchicken β-actin promoterAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Hygro-sgSIK3
Plasmid#138699PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK3
Plasmid#138697PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
POLR2A-N CRISPR pX330
Plasmid#124495PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2ADepositorInsertPOLR2A targeting CRISPR
UseCRISPRPromoterU6 promoterAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Crys
Plasmid#164967PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgCry1_2-hU6-sgCry2_1-hU6-sgCry2_2
UseAAVTagsmCherryPromoterhU6, hSynAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-1
Plasmid#83934PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTCas9_scr
Plasmid#207566PurposeThermoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only