We narrowed to 25,161 results for: promoter
-
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_213
Plasmid#133456PurposeH1 promoter expresses customizable Saur-guide; EF1a promoter expresses SpyoCas9 and 2A site provides blasticidin resistanceDepositorInsertControl guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E1.1-RFP
Plasmid#22928DepositorInsertE1.1 binding site from Scardigli et al., 2003 with minimal CMV
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 beta-catenin Y654E
Plasmid#16073DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
NK73
Plasmid#176609PurposeTo test bead engulfment of macrophages.DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
MBD1v1 pcDNA3.1
Plasmid#78140PurposeMammalian expression of MBD1v1DepositorAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEBG-TFII-I delta isoform
Plasmid#22188DepositorAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pENTR_hEMSY
Plasmid#125156PurposeGateway entry cloneDepositorInsertEMSY (EMSY Human)
UseGateway entry vectorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
USP19 sgRNA2
Plasmid#78586Purposedelete USP19 gene in human cellDepositorAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
1456_pDEST_miniTol2_R4-R2_Cryst-eGFP
Plasmid#171795PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a eGFP selection marker (Crystallin promoter Lens/Eyes)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
TOPO pTRE
Plasmid#68457PurposeTOPO construct expressing pTRE for generation of GMAP-compatible promoterDepositorInsertTetracycline Response Element Promoter
UseGmapExpressionBacterialPromoterPlacAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR9/9*
Plasmid#177805PurposeThe pre-miR-9/9* sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-9/9*
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Rabin8
Plasmid#24910DepositorInsertRabin8 (RAB3IP Human)
UseGateway entry vectorAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crScaffold_SV40-BFP
Plasmid#224860PurposecrRNA scaffold for RfxCas13d expressed from hU6 promoter and reporter BFP protein expressed from SV40 promoterDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLPP3
Plasmid#209965PurposeContains Level 0 Part: constitutive Promoter (P25) for the construction of Level 1 plasmidsDepositorInsertPromoter (P25)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP7
Plasmid#209969PurposeContains Level 0 Part: autoinducible Promoter (PfabZ) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_fabZ)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP8
Plasmid#209970PurposeContains Level 0 Part: autoinducible Promoter (PgadB) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_gadB)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP9
Plasmid#209971PurposeContains Level 0 Part: constitutive Promoter (PldhD) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_ldhD)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP1
Plasmid#209963PurposeContains Level 0 Part: mock / negative control Promoter (P-nc) for the construction of Level 1 plasmidsDepositorInsertPromoter (mock)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits