We narrowed to 6,765 results for: sas
-
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR FL CPAP RNAi resistant
Plasmid#46390DepositorInsertCPAP RNAi resistant mutant (CENPJ Human)
UseEntry vectorMutationsilent mutation that renders it resistant to siRN…Available SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B S. aureus, Synthetic, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoter;Available SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
OCT4 GFP puro Donor 2
Plasmid#22210DepositorInsertSA-OCT-GFP-2APuro-PA (POU5F1 Human)
Available SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
OCT4 GFP puro Donor 3
Plasmid#22211DepositorInsertSA-OCT-GFP-2APuro-PA (POU5F1 Human)
Available SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA1
Plasmid#201594PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
rag2:TSPAN31_CE_pISceI
Plasmid#223025PurposeExpress TSPAN31 gene in mesenchymal lineage of Zebrafish.DepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA2
Plasmid#201595PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
MoFGFR31c-ires neo
Plasmid#86496Purposemamalian cell expression of FGFR3-FGFR1 chimeraDepositorExpressionMammalianMutationFGFR3-FGFR1 chimeraPromoterMoloney murine leukemia virus LTRAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
MoFGFR31b-ires neo
Plasmid#86495Purposemamalian cell expression of FGFR3-FGFR1 chimeraDepositorExpressionMammalianMutationFGFR3-FGFR1 chimeraPromoterMoloney murine leukemia virus LTRAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLIB_BSSHI_6xHisTEV-WIPI2d
Plasmid#190863PurposePlasmid for the expression of purification of WIPI2d: SMC Internal reference: SMC1216DepositorInsertWIPI2 (WIPI2 Human)
ExpressionBacterial and InsectMutationSNP C to G at position 4562 (Val)Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCLP-2/pCMV (100)
Plasmid#24421DepositorInsertPCLP-2 (PODXL2 Human)
ExpressionMammalianAvailable SinceSept. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
poGFP1
Plasmid#154127PurposeExpresses orthogonal gfp gene in bacterial cellsDepositorInsertorthogonal gfp
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDonor_AcCAST_kanR
Plasmid#127925PurposeKanamycin resistance donor for AcCASTDepositorInsertKanR
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS xChordin
Plasmid#24975DepositorInsertChordin (chrd.1.S Frog)
ExpressionBacterialAvailable SinceJune 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBS xenopus Endodermin (pBS-eddL6)
Plasmid#24968DepositorInsertEndodermin (a2m Frog)
ExpressionBacterialAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
poLuc1
Plasmid#154128PurposeExpresses orthogonal firefly luciferase gene in bacterial cellsDepositorInsertorthogonal firefly luciferase
UseSynthetic BiologyExpressionBacterialAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDonor_ShCAST_kanR
Plasmid#127924PurposeKanamycin resistance donor for ShCASTDepositorInsertKanR, R6K origin of replication
Available SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRBS wt
Plasmid#154126PurposeExpresses wt rRNAs operon in bacterial cellsDepositorInsertwt bacterial rRNAs operon under control of pL promotor
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only