We narrowed to 6,023 results for: cat.2
-
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-BTRC-MGMT_2
Plasmid#136416PurposeLentiviral expression of gRNAs targeting intron 2 of human BTRC and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(BTRC)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_2
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
mdm1_pJet1.2
Plasmid#121977Purposefor generating mdm1 riboprobes for WISH in zebrafishDepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEAF1.2.2-gDNA
Plasmid#113799PurposeCRISPR plasmid for expression of Cas9 nicakse (D10A) and gRNA targeting human transcription factor DEAF1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF266.2.0-gDNA
Plasmid#112402PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF266DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-sgTAF12(human)#4.5
Plasmid#105987Purposelentivirally express gRNA targeting human TAF12 HFD with GFP markerDepositorInsertgRNA targeting human TAF12-HFD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1211_BB2_E_AB_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90285PurposeBB2 with split pyrG marker for homologous integration with linker AB (negative control)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1212_BB2_E_BC_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90286PurposeBB2 with split pyrG marker for homologous integration with linker BC (for 1 expression cassette)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1213_BB2_E_CD_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90287PurposeBB2 with split pyrG marker for homologous integration with linker CD (for 2 expression cassettes)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1214_BB2_E_DE_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90288PurposeBB2 with split pyrG marker for homologous integration with linker DE (for 3 expression cassettes)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT2 Cav2.2 DomI and DomII
Plasmid#89891PurposeMammalian expression of Cav2.2 DomI and DomII, this contains the first 2 domains (amino acids 1 -1154) of Cav2.2DepositorInsertCacna1b (CACNA1B )
ExpressionMammalianMutationStop codon after amino acid 1154 (this is a trunc…Promoteradenovirus major late promoterAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF792_2
Plasmid#86340PurposeEncodes gRNA for 3' target of human ZNF792DepositorInsertgRNA against ZNF792 (ZNF792 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HOMEZ_2
Plasmid#86353PurposeEncodes gRNA for 3' target of human HOMEZDepositorInsertgRNA against HOMEZ (HOMEZ Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_2
Plasmid#86322PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX_sh_hBcl10_#2
Plasmid#75254Purposeretroviral shRNA vector against human BCL10, expresses GFP for transduction controlDepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only