We narrowed to 6,669 results for: PROC
-
Plasmid#29043DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceDec. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1488
Plasmid#29239DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1294
Plasmid#29145DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEB2-mScarlet
Plasmid#104006PurposePlasmid encoding mScarletDepositorInsertmScarlet
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGE AVIKEF… N6A, R…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mCherry2-L
Plasmid#104003PurposePlasmid encoding mCherry2-LDepositorInsertmCherry2-L
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGEE NNLA IIKEF… V…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRuby3 Addgene
Plasmid#104005PurposePlasmid encoding mRuby3 AddgeneDepositorInsertmRuby3 Addgene
UseLow copyExpressionBacterialMutationMutations relative to eqFP611 (MSKGEE LIKENMRMKVV…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRuby3
Plasmid#104004PurposePlasmid encoding mRuby3DepositorInsertmRuby3
UseLow copyExpressionBacterialMutationMutations relative to eqFP611 (MSKGEE LIKENMRMKVV…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mScarlet-I
Plasmid#104007PurposePlasmid encoding mScarlet-IDepositorInsertmScarlet-I
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGE AVIKEF… N6A, R…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1602
Plasmid#29305PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748) and de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle131 (MKI67 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1246
Plasmid#29127PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1225
Plasmid#29113PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1228
Plasmid#29114PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1113
Plasmid#29042PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1052
Plasmid#29004PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceAug. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1384
Plasmid#29304PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorInsertPle185
TagsEGFP-NLSAvailable SinceNov. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1172
Plasmid#29301PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorAvailable SinceJan. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1613
Plasmid#29278PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle141 (NR2E1 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceJan. 9, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1229
Plasmid#29115PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceOct. 3, 2011AvailabilityAcademic Institutions and Nonprofits only