We narrowed to 13,167 results for: Green Fluorescent Protein
-
Plasmid#127505PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 4 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
ExpressionMammalianAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AL62_pDonor.DMD.TS
Plasmid#100287PurposeDMD intron 43-targeting plasmidDepositorInsertEGFP expression unit (DMD Synthetic, Human)
UseCRISPR and Synthetic Biology; Human targetingExpressionMammalianAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOBCol2.3MCSpA
Plasmid#109485PurposeDrive inserted gene in osteoblasts.DepositorTypeEmpty backboneTagsNoneExpressionMammalianAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti.pFOXA2.5'.GFP
Plasmid#59407Purposeexpresses eGFP from an about 1350 bp human FOXA2 promoter to select floor plate and ventral midbrain progenitor cells during developmentDepositorInsertapprox. 1350 bp FOXA2 promoter, eGFP (FOXA2 Human)
UseLentiviralExpressionMammalianPromoterFOXA2Available sinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-RCC
Plasmid#190635PurposeMammalian expression of genetically encoded calcium indicator RCCDepositorInsertRCC
ExpressionMammalianAvailable sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-SCcpV
Plasmid#190636PurposeMammalian expression of genetically encoded calcium indicator SCcpVDepositorInsertSCcpV
ExpressionMammalianAvailable sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)Bxb1
Plasmid#127511PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionMammalianAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSRG11 (eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3’UTR)
Plasmid#245121PurposeOptimized SunTag antibody for expression in C. elegans. Useful for visualization of translation of GCN4 encoding mRNAs or for visualization of GCN4-tagged proteinsDepositorInsertseft-3p
scFv (GLO)
GFP (GLO)
tbb-2 3'UTR
left recombination arm MosSCI ttTi5605
right recombination arm MosSCI ttTi5605
ExpressionBacterial and WormAvailable sinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-P3-IgKL-SpyCatcher003-mNeonGreen
Plasmid#234543Purposeto express a green fluorescent protein tagged with SpyCatcher in the liverDepositorPublicationInsertIgKL-SpyCatcher003-mNeonGreen
UseAAVMutationNonePromoterP3Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-RAB7A-IRES-Puromycin
Plasmid#133027PurposeExpresses EGFP-tagged late endosome markerDepositorInsertRAB7A (RAB7A Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterHuman elongation factor 1 alphaAvailable sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRoCascade_gfp
Plasmid#178771PurposeExpression of Rocas6, Rocas8, Rocas7, Rocas5, RoCAST CRISPR repeat, gfp from Rippkaea orientalisDepositorInsertRocas6, Rocas8, Rocas7, Rocas5, RoCAST CRISPR repeat, gfp from Rippkaea orientalis
ExpressionBacterialAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS2155
Plasmid#141065PurposeAAV plasmid with SYN1 promoter driving expression of EmGFP. Contains WPRE.DepositorInsertSYN1-EmGFP-WPRE
UseAAVPromoterhuman SynapsinAvailable sinceApril 28, 2021AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
Gfp-rt-vasa
Plasmid#167322PurposePlasmid for synthesis of GFP chimeric RNA that contained vasa-3'UTRs of rainbow trout by in vitro transcription.DepositorInsertrt vasa 3'UTRs (ddx4 rainbow trout)
ExpressionBacterialAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
VCP(A232E)-EGFP
Plasmid#23973DepositorPublicationInsertValosin containing protein (VCP Human)
Tags6xHis, EGFP, and HAExpressionMammalianMutationA232EAvailable sinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCHMP3-NS3-Green
Plasmid#223527PurposeMammalian expression of CHMP3 fused to the hepatitis C virus protease NS3 through a short linker containing the NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP3 (CHMP3 Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
XE70 NLS Beta-catenin GFP in CS2+
Plasmid#16838DepositorAvailable sinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-hfYFP
Plasmid#191201PurposeConstitutive CAG-driven expression of hfYFP in animals using AAVDepositorInsertHyperfolder YFP
UseAAVExpressionMammalianMutationmGreenLantern-F46L/C48S/V68L/A69M/C70V/K101E/T105…PromoterCAGAvailable sinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-LAMP-1-mGFP-IRES-Puromycin
Plasmid#134868PurposeExpresses EGFP-tagged lysosomal markerDepositorInsertLysosomal-associated membrane protein 1 (LAMP1 Human)
UseLentiviralTagsGFPExpressionMammalianPromoterEF1aAvailable sinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by