We narrowed to 23,769 results for: Spr
-
Plasmid#154094PurposeSelf-Cutting and Integrating CRISPR backbone targeting human TCR-alpha common chainDepositorInsertsgRNA and BAIT targeting human TRAC locus
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_116_LVL2 cam
Plasmid#179332PurposeNT-CRISPR plasmid for a single gRNA.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL0284 (pQCascade_entry)
Plasmid#130635PurposeExpresses V. cholerae CAST TniQ, Cas8, Cas7, and Cas6 from one T7 promoter, and a CRISPR RNA from a second T7 promoter. The CRISPR array contains two BsaI sites for spacer cloning.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(entry)
UseCRISPR; TransposonTagsExpressionBacterialMutationPromoterT7Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT3TS nErCas12an
Plasmid#132642PurposeUsed for in vitro transcription of dual NLS ErCas12a mRNADepositorInsertErCas12a
UseCRISPR; In vitro transcriptionTagsSV40 NLSExpressionMutationPromoterT3Available sinceNov. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262-ABE8e
Plasmid#161523PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE8e mediated A-G base editingDepositorInsertABE8e-zSpCas9(D10A)
UseCRISPR; Gateway compatible abe8e-zspcas9(d10a) en…TagsExpressionPlantMutationPromoterAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262m
Plasmid#161522PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE7.10 mediated A-G base editingDepositorInsertTadA(wt)-TadA(7.10)-zSpCas9(D10A)
UseCRISPR; Gateway compatible tada(wt)-tada(7.10)-zs…TagsExpressionPlantMutationPromoterAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRTagsExpressionMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-tRNApromo-sgRNA-espCas91_1
Plasmid#167210PurposePlasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pErCas12a EZ Clone
Plasmid#132641PurposeExpresses ErCas12a and an sgRNA to target a region of interestDepositorInsertErCas12a
UseAAV and CRISPRTags3x HA and SV40 NLSExpressionMammalianMutationQ926R (Please see depositor comments) and BsaI si…PromoterCMV PromoterAvailable sinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
-
pGMC00009 (aka pRC0494)
Plasmid#195294PurposeLenti-CRISPR-V2-GFP-2A-Puro - vector with Cas9/sgRNA backbone/Puro/GFPDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGMC00010 (aka pRC0495)
Plasmid#195295PurposeLenti-CRISPR-V2-RFP-2A-Puro - vector with Cas9/sgRNA backbone/Puro/RFPDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-G6
Plasmid#73437PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6.DepositorInsertRepressor G6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
T1-araC-Pbad-D10A/H840A cas9 ABCD-pACYC-BB
Plasmid#110547PurposeCRISPR interference; works in conjunction with an sgRNA expression vector to silence genes in the E. coli chromosome.DepositorInsertdCas9
UseTagsExpressionBacterialMutationD10A, H840APromoterpBADAvailable sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ8-T_dCas9
Plasmid#74062PurposepZ8-1 plasmid carrying dcas9, driven by the IPTG-inducible Ptac promoter, KanRDepositorInsertdcas9
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCascade_SPS1(PmcCAST)
Plasmid#224926PurposeExpression and purification of type I-B2 Cascade in CRISPR-associated transposon of RomsettaDepositorInsertsCas5, Cas6, Cas7, Cas8, Cas11
CRISPR assay for crRNA expression
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAL-pyk_NT
Plasmid#74072PurposepAL374 plasmid carrying the pyk (NT) sgRNA targeting the non-template strand of pyk, SpecRDepositorInsertsgRNA pyk (NT)
UseCRISPRTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL-pgi_T
Plasmid#74066PurposepAL374 plasmid carrying the pgi (T) sgRNA, targeting the template strand of pgi, SpecRDepositorInsertsgRNA pgi (T)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL-pck_T
Plasmid#74068PurposepAL374 plasmid carrying the pck (T) sgRNA targeting, the template strand of pck, SpecRDepositorInsertsgRNA pck (T)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL-pck_NT
Plasmid#74069PurposepAL374 plasmid carrying the pck (NT) sgRNA, targeting the non-template strand of pck, SpecRDepositorInsertsgRNA pck (NT)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL-pgi_NT
Plasmid#74067PurposepAL374 plasmid carrying the pgi (NT) sgRNA, targeting the non-template strand of pgi, SpecRDepositorInsertsgRNA pgi (NT)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-pgaC
Plasmid#154919PurposeaTc inducible gRNA targeting pgaC along with arabinose-inducible lambda red enzymesDepositorInsertgRNA targeting pgaC
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterpTetAvailable sinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAL-pyk_T
Plasmid#74070PurposepAL374 plasmid carrying the pyk (T) sgRNA targeting the template strand of pyk, SpecRDepositorInsertsgRNA pyk (T)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only