We narrowed to 33,800 results for: IND
-
Plasmid#138454PurposeExpresses BcRF1-ORF24 chimera with a C-terminal 2xStrep tag in mammalian cellsDepositorTagsStrepExpressionMammalianMutationBcRF1 amino acids 1-178 fused to ORF24 amino acid…PromoterCMVAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA4/TO-UL87-ORF24-2xStrep
Plasmid#138455PurposeExpresses UL87-ORF24 chimera with a C-terminal 2xStrep tag in mammalian cellsDepositorTagsStrepExpressionMammalianMutationUL87 amino acids 1-248 fused to ORF24 amino acids…PromoterCMVAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307Y-pKK223
Plasmid#131381PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307Y in Gs MutY.DepositorInsertEcNGsC MutY chimera F307Y
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-pKK223
Plasmid#131382PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308V-pKK223
Plasmid#131393PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.DepositorInsertEcNGsC MutY chimera S308V
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308A-pKK223
Plasmid#131394PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 NPm
Plasmid#126593PurposeExpresses siRNA resistant SENP2 (nuclear pore mutant) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
TagsFLAGExpressionMammalianMutationDeletion of amino acids 1-65 and L329A/L331A in t…PromoterCMVAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 CCm
Plasmid#126594PurposeExpresses siRNA resistant SENP2 (coiled-coil deletion) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
TagsFLAGExpressionMammalianMutationDeletion of amino acids 203-228 and siRNA resista…PromoterCMVAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-Klf4 TALE-GCN4
Plasmid#120546PurposeExpress 3xNLS-Klf4 TALE-GCN4 engineered to bind a site in the human KLF4 geneDepositorAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSlick-Neo-KANK1
Plasmid#121983PurposeTetracycline-inducible expression of untagged full-length KANK1DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-mTRF1deltaBLM
Plasmid#64163PurposeRetroviral vector expressing mouse TRF1 lacking BLM-binding motifs with N-terminal Myc tagDepositorInsertmTRF1 (Terf1 Mouse)
UseRetroviralTagsMycExpressionMammalianMutationDeleted amino acids 313-316 and 339-342 (both BLM…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PDi-CRISPRn
Plasmid#73500PurposeDox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locusDepositorInsertsCas9
rtTA
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCAG and TREAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Puro
Plasmid#79049PurposeExpresses human NEUROGENIN2 (hNGN2) and puromycin resistance gene under control of TetON promoter. This lentiviral vector is used to generate NGN2-iNs (induced neurons) from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 mHIF-1α MYC (P402A/P577A/N813A)
Plasmid#44028DepositorInsertmHIF-1α (P402A/P577A/N813A) (Hif1a Mouse)
TagsMycExpressionMammalianMutationP402A, P577A, N813APromoterCMVAvailable SinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG_Xph20-mRuby2-CCR5TC
Plasmid#135531PurposeEncodes a specific PSD-95 binder (Xph20) fused to mRuby2, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph20
TagsmRuby2ExpressionMammalianPromoterCAGAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FuG-E
Plasmid#67509PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. If you use this plasmid, you can make type E envelope coating virus particle with NeuRet.DepositorInsertFusion Glycoprotein type E
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG_Xph15-mNeonGreen-CCR5TC
Plasmid#135533PurposeEncodes a specific PSD-95 binder (Xph15) fused to mNeonGreen, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph15
TagsmNeonGreenExpressionMammalianPromoterCAGAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
V5-ERG
Plasmid#118623PurposeExpresses V5 tagged ERG proteinDepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only