We narrowed to 146,921 results for: ins;
-
Plasmid#220442PurposeConstruct used to generate the PUF3/PUP2/3HA tagging strains. (aka pBSII/PUF3 5’ flank/PUP2-DADA/3HA/URA3/PUF3 3’ flank)DepositorAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
RT-4
Plasmid#220443PurposeConstruct used to generate the PUF3/PUP2/3HA tagging strains. Surrounding the PUP2/3HA/URA3 are large regions of homology to integrate at the 3’ end of the PUF3 gene.DepositorAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-A51P/A56P
Plasmid#216400PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with A51/A56 to proline mutationsDepositorInsertEfg1-ΔDBD-A51P/A56P
UseTags6xHis-tagsExpressionBacterialMutationchanged Alanine 51 and 56 to Proline, and deleted…PromoterAvailable SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Q443P
Plasmid#216401PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Q443 to proline mutationDepositorInsertEfg1-ΔDBD-Q443P
UseTags6xHis-tagsExpressionBacterialMutationchanged Glutamine 443 to Proline, and deleted ami…PromoterAvailable SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_41BBICD
Plasmid#197097PurposeThis plasmid contains the coding sequence for the intracellular domain of 4-1BB. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of 4-1BB.
UseTagsExpressionMammalianMutationPromoterAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_CD28ICD
Plasmid#197098PurposeThis plasmid contains the coding sequence for the intracellular domain of CD28. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of CD28.
UseTagsExpressionMammalianMutationPromoterAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-bullfrog saxiphilin
Plasmid#140595Purposeprotein expressionDepositorInsertsaxiphilin bullfrog
UseTagsGFP-His10ExpressionInsectMutationDeletion of M20 - please see depositor commentPromoterpolyhedrin promoterAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
MsACR1-pmCerulean3-N1
Plasmid#204958PurposeExpression of channelrhodopsin MsACR1 fused to mCerulean3 in mammalian cellsDepositorInsertMsACR1
UseTagsmCerulean3ExpressionMammalianMutationPromoterCMV (+enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-MaUPPS-B
Plasmid#203175PurposeYeast expression vector for accessory subunit of Methanosarcina acetivorans cis-prenyltransferaseDepositorInsertMA_4402
UseTagsExpressionYeastMutationPromoterTDH3Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-MaUPPS-A
Plasmid#203174PurposeYeast expression vector for catalytic subunit of Methanosarcina acetivorans cis-prenyltransferaseDepositorInsertuppS
UseTagsExpressionYeastMutationPromoterTDH3Available SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-CePAN3_1-244_P
Plasmid#147243PurposeInsect Expression of CePAN3_1-244DepositorInsertCePAN3_1-244
UseTagsExpressionInsectMutationInsertion of two AA (FQ) at position 172 compared…PromoterAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGAL1-VP1 (LEU2)
Plasmid#182480PurposeYeast integrative plasmid for expressing deltaVP1, an NLS deletion mutant of Murine polyomavirus VP1 (GAL1 promoter). Contains leucine auxotrophic marker (K. lactis LEU2).DepositorInsertdeltaVP1
UseSynthetic Biology; Metabolic engineeringTagsExpressionYeastMutationPromoterGAL1Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
mRuby3 only VLP
Plasmid#182429PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and mRuby3 tagged with VP2C (GAL10 promoter). mRuby3 was codon-optimised for E. coli. Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-mRuby3
deltaVP1
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL1 and GAL10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRPF4.001.169
Plasmid#137233PurposeExpresses N-terminal (His)6-TEV cleavage site fusion of human gene or portion of gene in bacterial strains. pET based vector.DepositorAvailable SinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
ppwd1.473.646.W601A
Plasmid#137660PurposeExpresses N-terminal (His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorInsertppwd1 (PPWD1 Human)
UseTags(His)6-thrombinExpressionBacterialMutation473-646-W601APromoterAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM262 - pDESTR4-R3 mosTI hygroR target
Plasmid#159840PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertpDESTR4-R3 mosTI hygroR target
UseTagsExpressionWormMutationNot applicablePromoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-Rnt1-dsRBD(+6A)
Plasmid#171552PurposeEncoding part of the budding yeast Rnt1 protein from L366 to S453DepositorInsertRnt1 (RNT1 Budding Yeast)
UseTagsExpressionBacterialMutationa six-alanine insertion in the L1 regionPromoterAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-197
Plasmid#169924PurposeWT Ecm2 mutated to introduce stop codon after AA 197 of Ecm2DepositorInsertEcm2 1-197
UseTagsExpressionBacterial and YeastMutationPromoterAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
tcTRP9
Plasmid#175793Purposede novo thick circular tandem repeat proteins with 9 repeatsDepositorInserttcTRP9
UseTags6xHisExpressionBacterialMutationPromoterAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only