We narrowed to 1,480 results for: asl
-
-
-
pPICZ-pOst1-pro-alphaf(MUT2)-E2-Crimson
Plasmid#117663PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpOst1-pro-af(MUT2)-E2-Crimson
UseTagsExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogRFP (C90, JBEI-15908)
Plasmid#110143PurposeTransformation and expression of Csy4 and cogDsRed proteins in plantsDepositorInsertCsy4 (ATCS Mustard Weed)
UseBinary vectorTagscogDsRedExpressionBacterial and PlantMutationPromoterAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogGFP (C44, JBEI-16338)
Plasmid#110144PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorInsertCsy4 (ATCS Mustard Weed)
UseTagscogGFPExpressionBacterial and PlantMutationPromoterAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MLS-HyPer7
Plasmid#136470PurposeMammalian expression of mitochondrial matrix targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsTandem mitochondrial targeting signal of cytochro…ExpressionMammalianMutationPromoterCMV, SP6Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NES
Plasmid#136467PurposeMammalian expression of cytoplasm targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsNuclear export signal from the HIV Rev proteinExpressionMammalianMutationPromoterCMV, SP6Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HyPer7-MEM
Plasmid#136465PurposeMammalian expression of cytosolic side of plasma membrane targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsFarnselation tagExpressionMammalianMutationPromoterCMVAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+IMS-HyPer7
Plasmid#136469PurposeMammalian expression of mitochondrial intermembrane space targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsSMAC/DIABLOExpressionMammalianMutationPromoterCMV, SP6Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-E2-Crimson
Plasmid#117661PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-Ost1-alphaf(I)-E2-Crimson
UseTagsExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NLS
Plasmid#136468PurposeMammalian expression of nucleus targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsTriple nuclear localization signal of SV40 (simia…ExpressionMammalianMutationPromoterCMV, SP6Available sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-sumo-NSP12 (SARS-CoV-2)
Plasmid#159107PurposeThe SARS-CoV-2 NSP12 coding sequence was cloned into a modified pRSFDuet-1 vector (Novagen) bearing an N-terminal His6-SUMO-tag which is cleavable by the ubiquitin-like protease (ULP1).DepositorInsertNSP12
UseTagsHis-SUMO tagExpressionBacterialMutationNonePromoterT7Available sinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a 6xHis PreScission SARS-CoV-2 nsp13
Plasmid#159390PurposeExpresses the SARS-CoV-2 nsp13 protein with an N-terminal His6 tag followed by an HRV 3C/PreScission cleavage site.DepositorInsertN-terminal His tag PreScission SARS-CoV-2 nsp13, optimized for insect cell expression
UseTagsHis6 tagExpressionBacterialMutationPromoterT7Available sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralTagsExpressionMutationPromoterEF1aAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-Btl2
Plasmid#117667PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-alphaf(I)-Btl2
UseTagsExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
123_pAAV-ProC1-CatCh-GFP-WPRE
Plasmid#125937PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC1Available sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
anti-Desmin_D7-pBIOCAM5
Plasmid#39346DepositorInsertscFv-Fc-fusion specific for Desmin (clone D7) (DES Human)
UseTags3xFLAG, 6xHis, and human FcExpressionMammalianMutationPromoterAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-ProC3-Cre/mCherry
Plasmid#126006PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCre-2A-mCherry
UseAAVTagsExpressionMutationPromoterProC3Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
132_pAAV-ProB2-CatCh-GFP-WPRE
Plasmid#125922PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProB2Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA1-GCaMP6s
Plasmid#126002PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterProA1Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
161_pAAV-ProD5-CatCh-GFP-WPRE
Plasmid#125981PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProD5Available sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
113_pAAV-ProC21-CatCh-GFP-WPRE
Plasmid#125956PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC21Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
I_pAAV-ProA6-CatCh-GFP-WPRE
Plasmid#125890PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA6Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
198_pAAV-ProD1-CatCh-GFP-WPRE
Plasmid#125977PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProD1Available sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA18-GCaMP6s
Plasmid#126004PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterProA18Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProD1-GCaMP6s
Plasmid#126005PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterProD1Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
VI_pAAV-ProA7-GFP-WPRE
Plasmid#125891PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVTagsExpressionMutationPromoterProA7Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
136_pAAV-ProA1-CatCh-GFP-WPRE
Plasmid#125886PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA1Available sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
70_pAAV-ProA23-CatCh-GFP-WPRE
Plasmid#125906PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA23Available sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
57_pAAV-ProA14-CatCh-GFP-WPRE
Plasmid#125897PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA14Available sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
124_pAAV-ProC3-CatCh-GFP-WPRE
Plasmid#125939PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC3Available sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA5-GCaMP6s
Plasmid#126003PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterProA5Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
206_pAAV-ProD17-CatCh-GFP-WPRE
Plasmid#125993PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProD17Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
151_pAAV-ProC29-CatCh-GFP-WPRE
Plasmid#125964PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC29Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
III_pAAV-ProB4-CatCh-GFP-WPRE
Plasmid#125924PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProB4Available sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
17_pAAV-ProB1-CatCh-GFP-WPRE
Plasmid#125921PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProB1Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
107_pAAV-ProC17-CatCh-GFP-WPRE
Plasmid#125952PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC17Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only
