We narrowed to 526 results for: Gale
-
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-SUMO-CHMP2B
Plasmid#232018PurposeBacterial expression of His and SUMO tagged CHMP2BDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-ILF3-ts1
Plasmid#174265PurposeILF3 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-ILF3-ts2
Plasmid#174266PurposeILF3 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-ILF3-ts3
Plasmid#174267PurposeILF3 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPU-huMDA5-miR30-L1221
Plasmid#174223PurposeAll-in-one huMDA5 rescue-control shRNA knockdown vectorDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCB-Gal9NFcLALAPGhole6xHis
Plasmid#237381PurposepTwist CMV BetaGlobin encoding Galectin-9 N terminal carbohydrate binding domain-Fc fusion with LALA P329G hole Fc and 6xHis tagDepositorInsertGalectin-9-silentFc (N-terminal carbohydrate binding domain only) (LGALS9 Human)
Tags6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K963_GFP_SNAP
Plasmid#159727PurposeExpresses kinesin-1 (amino acids 1-963) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (full length, 1-963 amino acids), K963 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 a-syn A53T D115A mNeonGreen-3K-B11
Plasmid#232017PurposeBacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3KDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_ybbR_Tau
Plasmid#159717PurposeExpresses tau in Sf9 cells with a ZZ affinity tag and a ybbR tagDepositorInsertMicrotubule-associated protein tau (MAPT Human)
TagsZZ affinity tag, ybbR tagExpressionInsectAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K560_GFP_SNAP
Plasmid#159720PurposeExpresses kinesin-1 (amino acids 1-560) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (only amino acids 1-560), K560 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectMutationOnly amino acids 1-560Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-FGF6-V5
Plasmid#124090PurposeFGF6-V5 tagged expression vectorDepositorInsertFGF6 (FGF6 Human)
UseLentiviralTagsV5Mutation3 silent SNPs: (189) C>G, (366) T>C and (41…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K490_GFP_SNAP
Plasmid#159721PurposeExpresses kinesin-1 (amino acids 1-490) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (only amino acids 1-490), K490 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectMutationOnly amino acids (1-490)Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_ybbR_MAP7_N
Plasmid#159728PurposeExpresses MAP7 (amino acids 1-316) in Sf9 cells with a ZZ affinity tag and a ybbR tagDepositorInsertMAP7 (only amino acids 1-316)(includes MTBD and P123 domains) (MAP7 Human)
TagsZZ affinity tag and ybbR tagExpressionInsectAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-mRuby3-Gal8-P2A-Zeo
Plasmid#150815PurposeMammalian expression of mRuby3-Galectin8 (Gal8) fusion proteinDepositorInsertmRuby3-Gal8-P2A-Zeo (LGALS8 Human, Synthetic)
TagsGal8 is fused to the c-terminus of mRuby3ExpressionMammalianPromoterCAGAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only