We narrowed to 3,286 results for: cat.3
-
Plasmid#21929DepositorAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA-HaloGFP-Na2.4
Plasmid#228471PurposeMammalian expression of green fluorescent sodium ion indicator HaloGFP-Na2.4DepositorInsertHaloGFP-Na2.4
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HaloGFP-Na2.4
Plasmid#228470PurposeBacterial expression of green fluorescent sodium ion indicator HaloGFP-Na2.4DepositorInsertHaloGFP-Na2.4
ExpressionBacterialAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSJ340
Plasmid#27125DepositorInsertColicin Ia + Ia immunity protein
ExpressionBacterialAvailable SinceJan. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTAL6-BB
Plasmid#36034DepositorTypeEmpty backboneExpressionYeastPromoterPTEF1Available SinceJuly 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFA6 - iFAST
Plasmid#209414PurposeiFAST containing plasmid for endogenous fusion constructsDepositorInsertiFAST
ExpressionYeastPromoternoneAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
AP-SEMA3C (chick)
Plasmid#29449DepositorAvailable SinceJuly 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pOGG013
Plasmid#113987PurposeVector construction module. Endlinker/terminator module to circularize plasmid following Part 3DepositorInsertEndlinker/terminator Part 3
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(+6)-L3
Plasmid#205041PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(+6)-L3
TagsGRRGKKSRKGRRGKKSRKGRRGKKSRK and MGHHHHHGGAExpressionBacterialMutationE16R, D86K, D112K, D127R, I138R, D207R, N222K, L2…Available SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(+6)-H3
Plasmid#205044PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(+6)-H3
TagsKRRRKKKRRRKKKRRRKK and MGHHHHHGGAExpressionBacterialMutationE16R, D86K, D112K, D127R, I138R, D207R, N222K, L2…Available SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(0)-L3
Plasmid#205035PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(0)-L3
TagsGRRGKKSRKGRRGKKSRKGRRGKKSRK and MGHHHHHGGAExpressionBacterialMutationE16R, I138R, D207R, N222K, L246RAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(0)-H3
Plasmid#205038PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(0)-H3
TagsKRRRKKKRRRKKKRRRKK and MGHHHHHGGAExpressionBacterialMutationE16R, I138R, D207R, N222K, L246RAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
KIF1A(1-393)-GCN4-2xmCherry-EF(C)
Plasmid#61665PurposeTandem mCherry-labeled, forced-dimeric, truncated kinesin-3 fused to EF Hand linkerDepositorInsertKIF1A(1-393)-GCN4-2xmCherry-EF(C) (KIF1A Human)
ExpressionMammalianAvailable SinceMarch 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATX3-JD
Plasmid#184247PurposeRecombinant protein expression and purification. Encodes ataxin-3 Josephin domain fused with His-Tag (N-terminal)DepositorInsertAtaxin-3 Josephin domain (ATXN3 Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationPremature stop codon V183XPromoterT7 promoterAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
TKIT NFL gRNA1 gRNA2
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-DENV3-NS5FL
Plasmid#86013PurposeExpression of dengue virus 3 NS5 proteinDepositorInsertDENV3-NS5FL
Tagshexa-histidine tagExpressionBacterialMutationamino acid residues 6 to 895 of DENV3 NS5PromoterT7Available SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATX3-D1
Plasmid#184246PurposeRecombinant protein expression and purification. Encodes ataxin-3 Josephin domain and UIM1 fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 Josephin domain and UIM1 (ATXN3 Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationPremature stop codon N263XPromoterT7 promoterAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV intron 20xGCN4 Renilla Rh1 STOP 24xMS2v5 SV40 CTE polyA
Plasmid#105000PurposeExpresses ST-Renilla-Rh1 calibration reporter in mammalian cells; note plasmid contains 24xGCN4 repeatsDepositorInsertRenilla luciferase
Tags24xGCN4 repeats (SunTag), 24xMS2v5 stem loops in …ExpressionBacterial and MammalianPromoterTetCMVAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
ROSAFARY
Plasmid#13446DepositorInsertROSAFARY
UseRetroviralExpressionMammalianAvailable SinceNov. 16, 2006AvailabilityAcademic Institutions and Nonprofits only