We narrowed to 6,202 results for: cat.2
-
Plasmid#90144Purposecontains dll4 enhancer 2 sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_mScarlet_CLASP_RGS2membrane
Plasmid#133086PurposePlasmid contains mScarlet with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-mScarlet-yeLANS). CLASP modulates nuclear localization of mScarlet in response to blDepositorInsertmScarlet-CLASP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Hygromycin-TTF-1
Plasmid#119173PurposeRetroviral mammalian expression vector containing wt-human TTF-1 cDNADepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF-DEST51 HA-PNRC1
Plasmid#123294PurposeMammalian expression of PNRC1 N-HADepositorAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
(I) pADH2 (J) P3 (SBE114)
Plasmid#187629Purposepromoter of the gene alcohol dehydrogenase 2 from R. toruloides for the P3 position (I/J)DepositorInsert(I) pADH2 (J)
ExpressionBacterialAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
(F) pADH2 (G)_P2 (SBE113)
Plasmid#187628Purposepromoter of the gene alcohol dehydrogenase 2 from R. toruloides fro the P2 position (F/G)DepositorInsert(F) pADH2 (G)
ExpressionBacterialAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
(F) pXYL (G) P1 (SBE216)
Plasmid#195017Purposepromoter of the gene xylose reductase from R. toruloides for the position P2 (F/G)DepositorInsert(F) pXYL (G)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(R) pXYL (D) P1 (SBE215)
Plasmid#195016Purposepromoter of the gene xylose reductase from R. toruloides for the position P1 (R/D)DepositorInsert(R) pXYL (D)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(S) insD_ku70 (Q) (SBE139)
Plasmid#187627Purposethe insertional region downstream for the deletion of the KU70 gene in R. toruloides. Overhangs S/QDepositorInsert(S) insD KU70 (Q)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(P) insUP_ku70 (SBE138) (B)
Plasmid#187626Purposethe insertional region upstream for the deletion of the KU70 gene in R. toruloides. Overhangs P/BDepositorInsert(P) insUP KU70 (B)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC0.006
Plasmid#119670PurposeLevel 0 part. Promoter, cpc560 promoter, extended spacer region, upstream TFB site region duplicated.DepositorInsertPcpc560-Ux2
UseSynthetic BiologyMutationbp 89 T to C, bp 187 C to A, Duplicated upstream …Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSETa-Amrose v2
Plasmid#79538PurposepRSETa (Invitrogen) plasmid expressing Amrose variant 2DepositorInsertAmrose v2
Tags6xHis, T7 epitope, and Xpress tagExpressionBacterialPromoterT7Available SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-TTLL11
Plasmid#140582PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA TTLL11
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB_EF1a_Gag∆MA
Plasmid#212654PurposepiggyBac vector to express MLV Gag with truncated MA domainDepositorInsertMLV Gag (UniProt ID: P03332) (gag MoMLV)
UsePiggybacExpressionMammalianMutationDeletion of MA domain (amino acids 2-215)PromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-RGS8
Plasmid#140585PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA RGS8
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CHRNA7-mGFP
Plasmid#62629Purposemammalian expression of human Alpha7 (CHRNA7) with mEGFP fused into M3-M4 loopDepositorAvailable SinceMarch 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet-HSP70
Plasmid#163790PurposeExpresses mScarlet-Hsp70 in mammalian cellsDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only