We narrowed to 14,045 results for: crispr grnas
-
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-2
Plasmid#159930PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 atgRNA pDY2250
Plasmid#219860Purposeattachment site pegRNA for human NOLC1DepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-NT-1mer-gRNA
Plasmid#227500Purposenon-targeting control guideDepositorInsertNon-targeting gRNA
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-1x
Plasmid#164413PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-1xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-P3-evoCjCas9-ABE8e_gRNA
Plasmid#202559PurposeP3-evoCjCas9-ABE8e and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-ABE8e
UseAAVAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
gRNA-ura-HYB
Plasmid#64330Purposeura3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of ura3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA-trp-HYB
Plasmid#64331Purposetrp1 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of trp1 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA-leu-HYB
Plasmid#64332Purposeleu2 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of leu2 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA-his-HYB
Plasmid#64333Purposehis3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of his3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-2x
Plasmid#164414PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-2xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-BSD-T7-sgRNA
Plasmid#245119PurposePlasmid backbone to for inserting a T7 promoter driven guide RNA into the rDNA spacer of T. bruceiDepositorArticleTypeEmpty backboneUseCRISPRAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-T7-sgRNA
Plasmid#245108PurposePlasmid backbone to for inserting a T7 promoter driven guide RNA into the rDNA spacer of T. bruceiDepositorArticleTypeEmpty backboneUseCRISPRAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_ER-dAPEX-BFP2
Plasmid#236733PurposeDual sgRNA targeting CTRL expressing dAPEX-BFP targeting to ERDepositorInsertNegative CTRL
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only