We narrowed to 14,247 results for: Cas9
-
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-SYNPO
Plasmid#140587PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA SYNPO
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA4
Plasmid#100556PurposeExpresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAGDepositorInsertMYC sgRNA4
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP608-1
Plasmid#99484PurposeH2B::linker::GFP (contain 3 introns)::3XFlag::TEV::Myc::tbb-2 3UTRDepositorInsertH2B::linker::GFP with introns::3XFlag::TEV::Myc::tbb-2 3UTR
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDD401
Plasmid#91828PurposePmyo-2::GFP FP-slot donor for the SapTrap cloning systemDepositorInsertPmyo-2::GFP
UseCRISPRExpressionWormMutationNucleotide 489 of the myo-2 promoter was changed …Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-sbcB-N
Plasmid#220290PurposeGateway entry plasmid (attL1& attR5) expressing sbcB exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertsbcB-XTEN linker-LbCas12a
UseCRISPR; Gateway compatible sbcb-xten linker- lbca…ExpressionPlantAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-sbcB-N
Plasmid#220305PurposeGateway entry plasmid (attL1& attR5) expressing sbcB exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertsbcB-XTEN linker-zSpCas9
UseCRISPR; Gateway compatible sbcb-xten linker- zspc…ExpressionPlantAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-TREX2-N
Plasmid#244025PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-AtEXO1B-N
Plasmid#244024PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS2.1-mNeongreen
Plasmid#241016PurposeExpresses mNeongreen under control of Msg promoterDepositorInsertsmNeongreen
blasticidin-S deaminase
ExpressionYeastAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS1-mNeongreen
Plasmid#241014PurposeExpresses mNeongreen under control of Msg promoterDepositorInsertsmNeongreen
blasticidin-S deaminase
ExpressionYeastAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF6
Plasmid#242208Purpose35Sp::eGFP:35St cassette in L1 vector backbone. Expresses a nuclear localized eGFP protein for transient plant transformation.DepositorInsertLevel1 35Sp::eGFP:35St
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB109
Plasmid#223017PurposeCas9 and Csy4 with 5' and 3' targets (II) for Lotus callus assayDepositorInsertCas9 and Csy4 with 5' and 3' targets (II)
UseCRISPRExpressionPlantAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only