We narrowed to 3,442 results for: gfp lenti
-
Plasmid#107056PurposeExpression of wild-type Smarca4 (Brg1) with C-terminal super-folder GFP fusion.DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4 Mouse)
UseLentiviralTagsSuper-folder GFP (sfGFP)ExpressionMammalianMutationwild-typePromoterCAGAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
paGFP-Omp25
Plasmid#69598Purposeexpresses GFP-labeled mitochondrial outer membrane protein 25DepositorInsertpaGFP-Omp25 (Synj2bp Rat)
UseLentiviralTagsGFPExpressionMammalianMutationphotoactivatable GFP fused to rat Omp25 C-terminusPromoterCMVAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_L58R
Plasmid#101775PurposeExpresses mutant BAF (L58R) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSynapsin_NLS_GFP-P2A_SNAP_GluA2
Plasmid#170455PurposeExpresses SNAP tagged GluA2 in neuronal cellsDepositorAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
[#GS7-LV] DsRed GFP TEVp Zeo Switch - Recipient
Plasmid#233507PurposeLentiviral construct for the MitoTRACER genetic reporter to be expressed in the recipient cellsDepositorInsertDsRed loxP eGFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
[#GS15-LV] DsRed GFP TEVp Blast Switch - Recipient
Plasmid#233506PurposeLentiviral construct for the MitoTRACER genetic reporter to be expressed in the recipient cellsDepositorInsertDsRed loxp eGFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro
Plasmid#141395PurposeLentiviral expression of SARS-CoV-2 protein; transient expression and generate lentivirusDepositorInserteGFP
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.KRAB-mArid3a.IRES.GFP
Plasmid#169306PurposeConstitutive overexpression of murine KRAB-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.VP64-mArid3a.IRES.GFP
Plasmid#169313PurposeConstitutive overexpression of murine VP64-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbleo-miRFP670nano(R57C/C86S)-P2A-EGFP
Plasmid#197370PurposeThe lentiviral vector for miRFP670nano(R57C/C86S) and EGFPDepositorInsertmiRFP670nano(R57C/C86S)
UseLentiviralTagsP2A-EGFPExpressionMammalianMutationR57C/C86S mutationPromoterCAGAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbleo-iRFP713(C15S/V256C)-P2A-EGFP
Plasmid#198062PurposeThe lentiviral vector for iRFP713(C15S/V256C) and EGFPDepositorInsertiRFP713(C15S/V256C)
UseLentiviralTagsP2A-EGFPExpressionMammalianMutationC15S/V256C mutationPromoterCAGAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1
Plasmid#10880DepositorAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch
Plasmid#10881DepositorAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pL(EF1a-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236279PurposeLentiviral vector that can express hAqp1 with fkbp12 degron in mammalian cells. EF1a promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterEF1aAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL(CMVtight-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236278PurposeLentiviral vector that can express doxycycline-inducible hAqp1 with fkbp12 degron in Tet ON mammalian cells. CMVtight promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterCMVtightAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Optopatch2 (QuasAr2-mOrange2-P2A-CheRiff-eGFP)
Plasmid#51656Purposehsyn promoting optopatch, which includes a ChR64, GFP, Quasar2 and mOrangeDepositorInsertQuasar2-mOrange-Chr64-GFP
UseLentiviralTagsGFP and mOrangeExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti NLuc398-G8NCRD IRES G8NCRD-CLuc394
Plasmid#128386PurposeExpresses a split firefly luciferase reporter based on the N terminal carbohydrate recognition domain of human galectin 8, which concentrates inside endosomes following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsC-terminal luc2 fragment and N-terminal luc2 frag…ExpressionMammalianMutationN terminal carbohydrate recognition domain fused …PromoterEF1A and IRESAvailable SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.neo_shGFP
Plasmid#110470PurposeControl, silence GFP gene, doxycycline inducible, neomycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.EFS.eGFP.mArid3a-3'UTR-WT
Plasmid#169299PurposeConstitutive overexpression of the 3'UTR of the murine Arid3a gene after a GFP, to evaluate miRNA binding. Regions not containing miR-125b or let-7c binding regions not included.DepositorAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.EFS.eGFP.ARID3A-3'UTR-WT
Plasmid#169297PurposeConstitutive overexpression of the 3'UTR of the human ARID3A gene after a GFP, to evaluate miRNA binding. Regions not containing miR-125b or let-7c binding regions not included.DepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X11
Plasmid#59235PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt7-ex2
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR13
Plasmid#59282PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsert17kb upstream krt5
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X39
Plasmid#59263PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt83-ex5-7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X33
Plasmid#59257PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt81-ex4-7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X14
Plasmid#59238PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt8-ex5-8
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR12
Plasmid#59281PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsert1.5kb upstream krt5
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X16
Plasmid#59240PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertkrt71-ex7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X10
Plasmid#59234PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt6b-ex5-9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X42
Plasmid#59266PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt84-ex9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X37
Plasmid#59261PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt82-ex7-8
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-INT1
Plasmid#59286PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intronic region of the keratin type II cluster.DepositorInsertKrt7-Intron 2
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X21
Plasmid#59245PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt75-ex9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X13
Plasmid#59237PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt7-ex7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X29
Plasmid#59253PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt79-ex8-9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X28
Plasmid#59252PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt79-ex7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X12
Plasmid#59236PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt7-ex6
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X36
Plasmid#59260PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt82-ex4-5
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X27
Plasmid#59251PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt79-ex5-6
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X30
Plasmid#59254PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt79-ex9 and 3' UTR
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC1-IGR20
Plasmid#59455PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the mouse keratin type I cluster.DepositorInsertmKrt14-5IGR
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC1-IGR16
Plasmid#59453PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type I cluster.DepositorInsertmK10-IGR5
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muEDC-IGR17
Plasmid#59454PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the mouse Epidermal Differentiation Complex.DepositorInsertmLor-IGR3
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X25
Plasmid#59249PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt78-ex7-8
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X23
Plasmid#59247PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt76-ex9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X44
Plasmid#59268PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertGm6042-ex2
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X43
Plasmid#59267PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt86-ex8-9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only