We narrowed to 3,557 results for: gfp lenti
-
Plasmid#17622DepositorAvailable SinceMarch 28, 2008AvailabilityAcademic Institutions and Nonprofits only
-
EF.hHES1.Ubc.GFP
Plasmid#17624DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
EF.hICN1.Ubc.GFP
Plasmid#17626DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP
Plasmid#63215PurposeExpression of eGFP in bacteria and in mammalian cells. Used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianPromoterCMV-EF1α hybrid (CEF)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF.mHES1.Ubc.GFP
Plasmid#17625DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.GFP.miR-21-3p.sensor.PGK.dNGFR.WPRE
Plasmid#85857PurposeSensor PlasmidDepositorAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.GFP.miR-16-2-3p.sensor.PGK.dNGFR.WPRE
Plasmid#85876PurposeSensor PlasmidDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.GFP.miR-151b.sensor.PGK.dNGFR.WPRE
Plasmid#85878PurposeSensor PlasmidDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-mCherry-EGFP-LC3B
Plasmid#170446PurposeLentiviral vector expressing tandem mCherry-EGFP-LC3B in mamalian cell. To visualize free autophagosome and autophagosomes that have fused with the lysosome.DepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUGW-Arl13b-N+RVEP+PR-EGFP-TurboID
Plasmid#248193PurposeLentiviral expression of truncated Arl13b containing the N-terminal amphipathic helix, cilium targeting RVEP, and the Proline-Rich domain at the C-terminus (cilium localization)DepositorInsertThe Arl13b cilium targeting sequence-EGFP-TurboID (Arl13b Mouse)
UseLentiviralTagsEGFP and TurboIDExpressionMammalianMutationTruncated to only contain N + RVEP + PR domainsPromoterhUBCAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-EGFP-PARP1
Plasmid#176146PurposeEGFP fused to the N-terminus of PARP1 & a hygromycin resistance cassetteDepositorInsertPoly(ADP-Ribose) Polymerase 1 (PARP1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hDNAJC6-T2A-copGFP
Plasmid#170443PurposeLentiviral vector expressing human DNAJC6 with copGFP reporter gene, under control of EF1alpha promoterDepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: TACGTTCTCTATCACTGATAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV-hGFAP-GFP
Plasmid#183906PurposeExpression of GFP under the human GFAP ABC1D promoterDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-DelGFP
Plasmid#133302PurposeEGFP reporter was removed in the TLCV2 vector so it could be used for inducible gene CRISPR knockout in cell lines with an eGFP reporter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX Nup62Fv2GFP
Plasmid#139683PurposeNup62 dimerization construct fused to 2 copies of GFP under an CMV promoterDepositorInsertNup62 (NUP62 Human)
UseLentiviralTags2 copies of GFP and Dimerization domain FKBPExpressionMammalianPromoterCMVAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
L13-Arl13bGFP
Plasmid#40879Purpose3rd generation transfer vectorDepositorAvailable SinceOct. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.GFP.miR-17-3p.sensor.PGK.dNGFR.WPRE
Plasmid#85866PurposeSensor PlasmidDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAIP Nup62Fv2GFP
Plasmid#139684PurposeNup62 dimerization construct fused to 2 copies of GFP under an SFFV promoterDepositorInsertNup62 (NUP62 Human)
UseLentiviralTags2 copies of GFP and Dimerization domain FKBPExpressionMammalianPromoterSFFVAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX GFP-HA
Plasmid#229501PurposeControl HA-tagged protein for immunoprecipitation experiments.DepositorInserteGFP
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-CoV2-WT
Plasmid#177618PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshiftingDepositorInsertSARS-CoV-2 FSE
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF.deltaBHES1.Ubc.GFP
Plasmid#24982DepositorInsertHES1 (HES1 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationDNA-binding domain disrupted by E43A, K44A, R47A …Available SinceJune 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
eGFP-HA_BASU
Plasmid#153996PurposeExpress eGFP gene along with HA and BASUDepositorInsertE-GFP
UseLentiviralExpressionMammalianAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-inGFPt
Plasmid#60237PurposeHIV-1 transfer vector that encodes gfp-turbo reporter gene interrupted by intronDepositorInsertinGFPt
UseLentiviralAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-R-GFP
Plasmid#246831PurposeExpress Arl13B-GFP in Arl13B KO RPE1 cells (sg1#a), resistance to sgRNADepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
LVDP 2P.2.EGFP
Plasmid#231905PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging EGFP mRNA into the VLPsDepositorUseLentiviralMutationR203M in N proteinPromoterCMV, EF-1aAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-ctrl
Plasmid#169305PurposeConstitutive overexpression of miR-ctrl with GFP as a reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsEGFPPromoterSFFVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAJS1205 GFP-Tau-1-50-T2A-mApple
Plasmid#250738PurposeVector for lentiviral expression of GFP-0N3R-Tau1_50-T2A-mAppleDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAJS1206 GFP-Tau-40-90-T2A-mApple
Plasmid#250739PurposeVector for lentiviral expression of GFP-0N3R-Tau40-90-T2A-mAppleDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
iNos-eGFP
Plasmid#207251PurposeReporter for expression of eGFP under control of iNos promoterDepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP C1
Plasmid#202424PurposeEncodes GFP aloneDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-99a
Plasmid#169304PurposeConstitutive overexpression of miR-99a with GFP as a reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWPT-mEGFP
Plasmid#190606PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)DepositorInsertsmEGFP
mCherry
UseLentiviralMutationa deletion was created in mCherry CDS impairing i…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR-ctrl.PGK.sfGFP.P2A.Tet3G
Plasmid#169316PurposeDoxycycline-inducible expression of miR-ctrl with dTomato as reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsdTomatoPromoterTREAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
LV-hNG2-GFP
Plasmid#183910PurposeExpression of GFP under the human NG2 promoterDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-BAF_L58R
Plasmid#101776PurposeExpresses EGFP tagged mutant BAF (L58R) in human cellsDepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceJan. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.eGFP-miR30n
Plasmid#90333PurposemiR30 based shMir knockdownDepositorInsertseGFP
na
SFFV
miR30n
UseLentiviralAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-Thy1.2-P2A-GFP-T2A-Nef
Plasmid#126553PurposeReplication incompetent HIV with H13L Tat and GFP-t2a-Thy1.2 reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsThy1.2 and GFPPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral FLAG-CaMKKbeta S129D, S133D, S137D
Plasmid#32460DepositorInsertCalcium/Calmodulin dependent protein kinase kinase beta (Camkk2 Mouse)
UseLentiviralTagsFLAGMutationS129D, S133D, S137DPromoterhuman PGKAvailable SinceFeb. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-VP64 dCas9 VP64-T2A-GFP
Plasmid#59791PurposeCo-expresses human optimized S. pyogenes dCas9 fused to two copies of VP64 and GFPDepositorInserthumanized VP64 dead Cas9 VP64 T2A GFP
UseCRISPR and LentiviralTagsFlagExpressionMammalianMutationD10A and H840AAvailable SinceOct. 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFP-BAF
Plasmid#101772PurposeExpresses EGFP tagged BAF in human cellsDepositorAvailable SinceJan. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
WT Smarca4-sfGFP
Plasmid#107056PurposeExpression of wild-type Smarca4 (Brg1) with C-terminal super-folder GFP fusion.DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4 Mouse)
UseLentiviralTagsSuper-folder GFP (sfGFP)ExpressionMammalianMutationwild-typePromoterCAGAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
paGFP-Omp25
Plasmid#69598Purposeexpresses GFP-labeled mitochondrial outer membrane protein 25DepositorInsertpaGFP-Omp25 (Synj2bp Rat)
UseLentiviralTagsGFPExpressionMammalianMutationphotoactivatable GFP fused to rat Omp25 C-terminusPromoterCMVAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_L58R
Plasmid#101775PurposeExpresses mutant BAF (L58R) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only