We narrowed to 4,936 results for: AAT
-
Plasmid#199564PurposegRNA expression for FnCas12a in E. coli and clostridiaDepositorInsertSacB
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPthl_fUAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_T2
Plasmid#184864PurposepSwap plasmid part containing the T2 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSWAP_Entry_T1
Plasmid#184863PurposepSwap plasmid part containing the T1 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-sgTel
Plasmid#122659PurposeExpresses sgRNA for telomere repeats with fluorescent indicator BFP and puromycin selection markerDepositorInsertBFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDropVn
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEX-2T Crkl
Plasmid#36400DepositorAvailable SinceJune 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458 pSp Cas9 Rhino1 tagA
Plasmid#211627PurposeCas9 Rhino1 tagADepositorInsertRHNO tagA
ExpressionMammalianPromoterU6Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA
Plasmid#121954PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA2.1
Plasmid#64117PurposeVector for expression of St1 sgRNA2.1 in mammalian cellsDepositorInsertSt1 sgRNA2.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8
Plasmid#121958PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, short version
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2.2
Plasmid#134751PurposePCR template for sgRNA cloningDepositorInsertsgRNA-TaU3p
UseCRISPRAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-slr0230-PL22-sgRNANT1-KmR
Plasmid#73224PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coliDepositorInsertPL22-sgRNA NT1
ExpressionBacterialPromoterPL22Available SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA1.1
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-mVenus
Plasmid#154898PurposemVenus entry vectorDepositorTypeEmpty backboneUseEntry vectorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-3'UTR
Plasmid#136041PurposeUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
p202_LTJ_sgRNACD45.2_R1
Plasmid#82672PurposesgRNA targeting murine CD45.2 region 1. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD45.2 region 1
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only