We narrowed to 9,280 results for: Pol;
-
Plasmid#159486PurposeTests for the impact of 8 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(8)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
KZ101: pMVP (L3-L2) P2A-eCFP + polyA
Plasmid#121768PurposepMVP L3-L2 entry plasmid, contains eCFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eCFP linked by P2A to gene of interest.DepositorInsertP2A-eCFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ301: pMVP (L3-L2) P2A-Blast + polyA
Plasmid#121779PurposepMVP L3-L2 entry plasmid, contains Blast-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Blast selection marker linked by P2A to gene of interest.DepositorInsertP2A-Blast + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ201: pMVP (L3-L2) P2A-Hygro + polyA
Plasmid#121782PurposepMVP L3-L2 entry plasmid, contains Hygro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Hygro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Hygro + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG901: pMVP (L3-L2) HA epitope tag + polyA
Plasmid#121749PurposepMVP L3-L2 entry plasmid, contains HA epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertHA epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
YIp128-P30-His-pol30(K127R)
Plasmid#99543PurposeYeast integrative vector for expression of His-tagged POL30 (PCNA) mutant K127R; Leu2 markerDepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Dnmt3b6-Poly(A)-NeoR
Plasmid#65552PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b6 cDNA into a MIN-tagged locus using Neomycin selectionDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 6Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-CasRX-P2A-EGFP-BGH PolyA
Plasmid#154004PurposeExpress CasRxDepositorInsertCasRx
UseCRISPRPromoterCAGAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-CAG-iGABASnFR2-WPRE-bGH-polyA
Plasmid#218868PurposeMammalian expression of improved GABA sensor (positive change in fluorescence)DepositorInsertiGABASnFR2
ExpressionMammalianMutationS99A F102Y F104Y L178SPromoterCAGAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(Hygro) myc-hPolQ-Flag
Plasmid#73132PurposeTo express in mammalian cells human PolQDepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-3XpolyA-3XPC-miniCMV-mCherry-WPRE-insulator
Plasmid#168291Purposeoptimized miniCMV (OminiCMV)DepositorInsertmCherry
ExpressionMammalianPromoterminiCMVAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
KL157 - pBlueScript II SK-Grb10_HA-T2A-eGFP-SV40PolyA
Plasmid#232935PurposeDonor plasmid for knock-in of T2A-eGFP-SV40pA at the mouse Grb10 locus. Used with PX459-sgRNA048_Grb10 sgRNA.DepositorInsertT2A-eGFP-SV40pA with Grb10 homology arms
UseMouse TargetingAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-5-SV40 polyA
Plasmid#190869PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode5
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for calcium ion
Plasmid#60887PurposeFPX biosensorDepositorInsertsingle polypeptide FPX biosensor for calcium ion
TagsHindIII siteExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA
Plasmid#192552PurposeExpresses nuclear localized tdTomato under CAG promoterDepositorHas ServiceAAV PHP.eB and AAV9InserttdTomato
UseAAVTagsNLSMutationdeleted E273 and G274 compared to FPbase ID: PGG5SPromoterCAGAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-eGFP_Y40N-MCS-polyA
Plasmid#174025PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInserteGFP
UseZebrafish knock-in taggingMutationY40NAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZH23 Dual G-less containing ySSA1 polyA
Plasmid#231647Purposeyeast S.cerevisiae SSA1 polyA termination region inserted between the dual G-less cassetteDepositorInsertSSA1 polyA termination region
UseSynthetic BiologyAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZH20 Dual G-less containing yCYC1 polyA
Plasmid#231646Purposeyeast S.cerevisiae CYC1 polyA termination region inserted between the dual G-less cassetteDepositorInsertCYC1 polyA termination region
UseSynthetic BiologyAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only