We narrowed to 21,453 results for: SPR
-
Plasmid#207786PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the TUBB4B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBB4B Addgene #207785DepositorInsertTUBB4B Homology Arms flanking a mNeon-Blast Cassette (TUBB4B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-MFAP2
Plasmid#185555PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting MFAP2DepositorInsertMFAP2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-TGFB2
Plasmid#185556PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting TGFB2DepositorInsertTGFB2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adrb1
Plasmid#184294PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adrb1DepositorInsertsgRNA-Adrb1
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.FLAG_NGFR
Plasmid#158240PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMB1052:miniTol2-U6-(empty)SaCas9_gRNA-CAG-Cre-P2A-NeoR-WPRE
Plasmid#168108PurposeTol2 transposon vector of empty U6-S.aureus Cas9 gRNA cassette and CAG-driven Cre-NeoRDepositorTypeEmpty backboneUseCRISPR and Cre/LoxAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00001
Plasmid#166718PurposesgRNA against human BAP1DepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244)
Plasmid#160566PurposeGBoligomers for the position [3_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (E3-E4-En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-NG-nCas9
Plasmid#163570PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-EE-UdgX-NG-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)NG (L111R, D1135V, G…Available SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_eA3A T31A-NG-nCas9
Plasmid#163539PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-NG-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)eA3A T31ANG (L111R, D1135V, G1218R, E…Available SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnj6
Plasmid#159913PurposeMutagenesis of Kcnj6DepositorInsertKcnj6 (Kcnj6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA1
Plasmid#138182Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA2
Plasmid#138183Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
STK38L gRNA (BRDN0001145817)
Plasmid#76629Purpose3rd generation lentiviral gRNA plasmid targeting human STK38LDepositorAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
SH3BP4 gRNA (BRDN0001149529)
Plasmid#78087Purpose3rd generation lentiviral gRNA plasmid targeting human SH3BP4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SH3BP4 gRNA (BRDN0001487091)
Plasmid#78089Purpose3rd generation lentiviral gRNA plasmid targeting human SH3BP4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
INSRR gRNA (BRDN0001147393)
Plasmid#78060Purpose3rd generation lentiviral gRNA plasmid targeting human INSRRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
INSRR gRNA (BRDN0001149046)
Plasmid#78061Purpose3rd generation lentiviral gRNA plasmid targeting human INSRRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKX gRNA (BRDN0001146094)
Plasmid#78016Purpose3rd generation lentiviral gRNA plasmid targeting human PRKXDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001147559)
Plasmid#78005Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001487102)
Plasmid#78006Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVR2A gRNA (BRDN0001148932)
Plasmid#77929Purpose3rd generation lentiviral gRNA plasmid targeting human ACVR2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK17A gRNA (BRDN0001149480)
Plasmid#77916Purpose3rd generation lentiviral gRNA plasmid targeting human STK17ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA4 gRNA (BRDN0001487122)
Plasmid#77919Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKA1 gRNA (BRDN0001145492)
Plasmid#77840Purpose3rd generation lentiviral gRNA plasmid targeting human PHKA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRSK1 gRNA (BRDN0001145276)
Plasmid#77784Purpose3rd generation lentiviral gRNA plasmid targeting human BRSK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAG1 gRNA (BRDN0001147838)
Plasmid#77745Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAG1 gRNA (BRDN0001149526)
Plasmid#77746Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IRAK3 gRNA (BRDN0001146930)
Plasmid#77714Purpose3rd generation lentiviral gRNA plasmid targeting human IRAK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IRAK3 gRNA (BRDN0001146977)
Plasmid#77715Purpose3rd generation lentiviral gRNA plasmid targeting human IRAK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAR2A gRNA (BRDN0001144926)
Plasmid#77674Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SEPHS2 gRNA (BRDN0001148921)
Plasmid#77661Purpose3rd generation lentiviral gRNA plasmid targeting human SEPHS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only