We narrowed to 10,769 results for: ESP
-
Plasmid#59822PurposeAllows the integration of myc Separase C2029A in the genome and Tet-inducible expressionDepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationC2029APromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-Cdh1
Plasmid#28127DepositorAvailable SinceMarch 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.1RT1-Pct5.1-crRNA(dadR)-RT(ΔdadR)
Plasmid#191635PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(dadR-targeting spacer) dadR-deleting repair template, used for dadR deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-DVC1-Strep-HA
Plasmid#113481PurposeExpression of human DVC1 with C-terminal strep-HA tagDepositorInsertDVC1 (SPRTN Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PSMD14 E6.4 gRNA
Plasmid#90859Purpose3rd generation lentiviral gRNA plasmid targeting human PSMD14DepositorInsertPSMD14 (Guide Designation E6.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATAD2 D7.3 gRNA
Plasmid#90538Purpose3rd generation lentiviral gRNA plasmid targeting human ATAD2DepositorInsertATAD2 (Guide Designation D7.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCL6-H2Kk-RV (H2K-BCL6)
Plasmid#40352DepositorAvailable SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-sfGFP-GMRWhite
Plasmid#165907PurposeBlasticidin resistant 5xUAS sfGFP GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLK1 G6.1 gRNA
Plasmid#90835Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorInsertPLK1 (Guide Designation G6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero7
Plasmid#187926PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero7DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pENTR4_CELF1
Plasmid#106098PurposeEntry vector for CELF1DepositorInsertCELF1 (CELF1 Human)
UseGateway entry vectorAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Casp8
Plasmid#48172Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of CASP8 (CASP8 Human)
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
KIF2A D7.2 gRNA
Plasmid#90720Purpose3rd generation lentiviral gRNA plasmid targeting human KIF2ADepositorInsertKIF2A (Guide Designation D7.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
KIF2A D8.2 gRNA
Plasmid#90721Purpose3rd generation lentiviral gRNA plasmid targeting human KIF2ADepositorInsertKIF2A (Guide Designation D8.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B12.2 gRNA
Plasmid#90623Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B12.2)
UseCRISPR and LentiviralPromoterU6Available SinceNov. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B11.2 gRNA
Plasmid#90622Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2QL1
Plasmid#124665PurposeExpresses UBE2QL1 with N-terminal Strep-HA tag in mammalian cellsDepositorAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only