Skip to main content

We narrowed to 9,235 results for: CAG

Showing: 5561 - 5580 of 9235 results
  1. pCfb13227

    Plasmid
    #219902
    Purpose
    The base plasmid of TUNEYALI for TF37
    Depositor
    Insert
    Contains gRNA targeting TF37 (YALI1_D01890g) and homologous arm matching TF37
    Expression
    Yeast
    Available Since
    June 5, 2024
    Availability
    Academic Institutions and Nonprofits only
  2. pCfb13240

    Plasmid
    #219913
    Purpose
    The base plasmid of TUNEYALI for TF50
    Depositor
    Insert
    Contains gRNA targeting TF50 (YALI1_F21426g) and homologous arm matching TF50
    Expression
    Yeast
    Available Since
    June 4, 2024
    Availability
    Academic Institutions and Nonprofits only
  3. pCfb13192

    Plasmid
    #219867
    Purpose
    The base plasmid of TUNEYALI for TF02
    Depositor
    Insert
    Contains gRNA targeting TF02 (YALI1_D21702g) and homologous arm matching TF02
    Expression
    Yeast
    Available Since
    June 4, 2024
    Availability
    Academic Institutions and Nonprofits only
  4. pCfb13201

    Plasmid
    #219876
    Purpose
    The base plasmid of TUNEYALI forTF11
    Depositor
    Insert
    Contains gRNA targeting TF11 (YALI1_E11341g) and homologous arm matching TF11
    Expression
    Yeast
    Available Since
    June 4, 2024
    Availability
    Academic Institutions and Nonprofits only
  5. pCfb13215

    Plasmid
    #219890
    Purpose
    The base plasmid of TUNEYALI for TF25
    Depositor
    Insert
    Contains gRNA targeting TF25 (YALI1_B18134g) and homologous arm matching TF25
    Expression
    Yeast
    Available Since
    June 4, 2024
    Availability
    Academic Institutions and Nonprofits only
  6. pCfb13248

    Plasmid
    #219919
    Purpose
    The base plasmid of TUNEYALI for TF58
    Depositor
    Insert
    Contains gRNA targeting TF58 (YALI1_F37742g) and homologous arm matching TF58
    Expression
    Yeast
    Available Since
    June 4, 2024
    Availability
    Academic Institutions and Nonprofits only
  7. hPLD4-sgRNA-Cas9_mcherry

    Plasmid
    #199343
    Purpose
    encodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherry
    Depositor
    Insert
    hSpCas9
    Use
    CRISPR
    Tags
    P2A-mCherry
    Expression
    Mammalian
    Mutation
    sgRNA: accagtagtatgaagccacg
    Promoter
    human U6
    Available Since
    May 22, 2024
    Availability
    Academic Institutions and Nonprofits only
  8. mU6-sgSik1_1st-hU6-sgNT

    Plasmid
    #177212
    Purpose
    Expresses a Sik1-targeting (mU6) and non-targeting (hU6) gRNAs, and Cre-recombinase
    Depositor
    Insert
    sgSik1_1st/sgNT1
    Use
    Lentiviral
    Promoter
    mU6/hU6
    Available Since
    Dec. 9, 2021
    Availability
    Academic Institutions and Nonprofits only
  9. pTOX.1.0-gDNA

    Plasmid
    #132470
    Purpose
    CRISPR/Cas9 plasmid to create GFP fusion proteins
    Depositor
    Insert
    TOX (TOX Human)
    Use
    CRISPR
    Available Since
    Dec. 23, 2019
    Availability
    Academic Institutions and Nonprofits only
  10. pLXIN2-RFP

    Plasmid
    #99205
    Purpose
    RFP expressing bicistronic retroviral vector
    Depositor
    Insert
    Red fluorescent protein
    Use
    Retroviral; Bicistronic retroviral expression vec…
    Expression
    Mammalian
    Mutation
    The dsRed cDNA was PCR amplified off AddGene plas…
    Available Since
    Aug. 28, 2017
    Availability
    Academic Institutions and Nonprofits only
  11. 1197R_gZBF-ER

    Plasmid
    #241825
    Purpose
    gRNA expressing plasmid with broken SEPARATOR
    Depositor
    Insert
    Actin5C promoter
    Use
    CRISPR
    Expression
    Insect
    Available Since
    Oct. 8, 2025
    Availability
    Academic Institutions and Nonprofits only
  12. Ring1-KO

    Plasmid
    #246224
    Purpose
    Knock out of Ring1
    Depositor
    Insert
    Ring1 gRNA (RING1 Human)
    Use
    Lentiviral
    Available Since
    Oct. 6, 2025
    Availability
    Academic Institutions and Nonprofits only
  13. pYJ15-PB-U6-Nkx6.1-acti-gRNA1

    Plasmid
    #131059
    Purpose
    Activation of NKX6.1 via SAM system
    Depositor
    Insert
    NKX6.1 activation gRNA1 (NKX6-1 Human)
    Use
    CRISPR
    Expression
    Mammalian
    Available Since
    Oct. 3, 2025
    Availability
    Academic Institutions and Nonprofits only
  14. pCAS-mak10 gRNA

    Plasmid
    #160385
    Purpose
    Expresses guide RNA for targeting MAK10 in yeast
    Depositor
    Insert
    mak10 gRNA
    Expression
    Yeast
    Promoter
    RNA pol III promoter (tRNA-Tyr)
    Available Since
    Feb. 8, 2023
    Availability
    Academic Institutions and Nonprofits only
Showing: 5561 - 5580 of 9235 results